elf3

Ensembl ID:
ENSDARG00000077982
ZFIN ID:
ZDB-GENE-030131-8760
Human Orthologue:
ELF3
Human Description:
E74-like factor 3 (ets domain transcription factor, epithelial-specific ) [Source:HGNC Symbol;Acc:33
Mouse Orthologue:
Elf3
Mouse Description:
E74-like factor 3 Gene [Source:MGI Symbol;Acc:MGI:1101781]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12768 Essential Splice Site Available for shipment Available now
sa18016 Essential Splice Site Available for shipment Available now
sa25170 Nonsense Mutation detected in F1 DNA During 2014
sa24046 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa12768
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113795 Essential Splice Site 123 375 3 8
Genomic Location:
Chromosome 22 (position 638018)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCTGAKTTTTGGWGGCTGCATGCATTAACAATCTTTTTGTTGCATCCCT[A/G]GTTAATGACCTRTCTGAGAACACCGTCCTGRGCGAATCCGAGTTTGAGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18016
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113795 Essential Splice Site 209 375 5 8
Genomic Location:
Chromosome 22 (position 638456)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
RCGCTCTGTGAACGAACATTAYTGAACATGTRCTTYGGTTTGTCCTGTGT[A/C]GGCAGCTTCCTGAACCCGAGCTCACCTGAGTCCAACAGCAGTGATTCTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25170
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113795 Nonsense 338 375 7 8
Genomic Location:
Chromosome 22 (position 639292)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTGGGGGCAGAAGAAGAAGAACAGCAGCATGACCTACGAGAAGCTCAGC[A/T]GAGCCATGAGGTATAAATCAATCCTAAAATCACTGGGGAGCCTGGGAGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24046
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113795 Essential Splice Site 341 375 7 8
Genomic Location:
Chromosome 22 (position 639304)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGAAGAAGAACAGCAGCATGACCTACGAGAAGCTCAGCAGAGCCATGAGG[T/C]ATAAATCAATCCTAAAATCACTGGGGAGCCTGGGAGCAATAGGGGAGTCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/86eqlqsr