LIMD1 (1 of 2)

Ensembl ID:
ENSDARG00000077964
Description:
LIM domains containing 1 [Source:HGNC Symbol;Acc:6612]
Human Orthologue:
LIMD1
Human Description:
LIM domains containing 1 [Source:HGNC Symbol;Acc:6612]
Mouse Orthologue:
Limd1
Mouse Description:
LIM domains containing 1 Gene [Source:MGI Symbol;Acc:MGI:1352502]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14416 Nonsense Available for shipment Available now
sa6404 Nonsense Mutation detected in F1 DNA During 2014
sa10287 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa14416
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110395 Nonsense 61 544 1 8
Genomic Location:
Chromosome 16 (position 3932992)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCAGGAAAGTKTTTGCCTCAAAAATGACYAAAATACACATCCAGAAGCAA[C/T]AGGAGGAGATGGCAAAAACCAGTTTGGCAGCAAGGATCAACGGGAGTCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6404
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110395 Nonsense 85 544 1 8
Genomic Location:
Chromosome 16 (position 3933065)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTGGCAGCAAGGATCAACGGGAGTCTTTCTAAAGTGTCGGATAACACAT[T/A]GTACACCAAAGACAGACCACCCATCAATACTTACAGACARGGCGGTGAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10287
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110395 Nonsense 435 544 5 8
Genomic Location:
Chromosome 16 (position 3964143)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGGCGCTGGGGAAGTCTTACCACCCAGGCTGCTTCCGCTGCGCCATCTG[T/A]AACGAGAGTCTRGACGGAGTGCCTTTCACTGTGGACACCGAGAACAAGAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/jfcmrwip