LOC566630

Ensembl ID:
ENSDARG00000077960
Human Orthologue:
SERPINA10
Human Description:
serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 10 [Source:HGNC Sy
Mouse Orthologues:
Gm46, Serpina10
Mouse Descriptions:
predicted gene 46 Gene [Source:MGI Symbol;Acc:MGI:2684892]
serine (or cysteine) peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 10 G

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa40446 Nonsense Mutation detected in F1 DNA During 2017
sa33619 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa40446
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051469 Nonsense 47 408 1 4
Genomic Location (Zv9):
Chromosome 5 (position 30436260)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 28198049
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACTCCCGTCATTGATAAACATGAACAACGATTTTGCTTTTCACCTGTAC[A/T]AAAGGGTTATTGAATTGCCTGACTATCAGTCCAAAAACATCTTCTTCTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33619
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051469 Nonsense 390 408 4 4
Genomic Location (Zv9):
Chromosome 5 (position 30438621)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 28200410
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATTGAGTATTTTAAAATTTAATCGCCCATTCATGATCTTTATCACGGAT[C/T]AAACAAATGACAACATCCTTTTCTTTGGGAAAGTCGTCAACCCAAATGAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link