ENSDARG00000077959

Ensembl ID:
ENSDARG00000077959
Human Orthologues:
HTR3C, HTR3D, HTR3E
Human Descriptions:
5-hydroxytryptamine (serotonin) receptor 3 family member D [Source:HGNC Symbol;Acc:24004]
5-hydroxytryptamine (serotonin) receptor 3, family member C [Source:HGNC Symbol;Acc:24003]
5-hydroxytryptamine (serotonin) receptor 3, family member E [Source:HGNC Symbol;Acc:24005]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa7498 Missense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa7498
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111824 Missense 326 463 7 9
Genomic Location:
Chromosome 22 (position 38255913)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTTTGCACTGATGGTGGCCAGTCTTCTGGAGACCATTTTTATCATAAATA[T/C]TCTGTGTGGCTCCGTTAACTATGGACCATTGCCYCGATGGGTCAARGTGC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/13ltkv7l