ENSDARG00000077959

Ensembl ID:
ENSDARG00000077959
Human Orthologues:
HTR3C, HTR3D, HTR3E
Human Descriptions:
5-hydroxytryptamine (serotonin) receptor 3 family member D [Source:HGNC Symbol;Acc:24004]
5-hydroxytryptamine (serotonin) receptor 3, family member C [Source:HGNC Symbol;Acc:24003]
5-hydroxytryptamine (serotonin) receptor 3, family member E [Source:HGNC Symbol;Acc:24005]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa43881 Nonsense Mutation detected in F1 DNA During 2016
sa37567 Nonsense Mutation detected in F1 DNA During 2016
sa7498 Missense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa43881
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111824 Nonsense 6 463 1 9
Genomic Location (Zv9):
Chromosome 22 (position 38265073)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 35413494
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAATTTTAATGACCTTATTCAATTTTAAATACTTGTATTATGAATATGTA[T/A]TCTTTTATTCTTCCAGCACTACTAATGACACCCACAGAGCCCATTAACTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37567
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111824 Nonsense 125 463 4 9
Genomic Location (Zv9):
Chromosome 22 (position 38261602)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 35410023
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGCAACCCTTCTCTAATTGTGTACTTTGCTTTTTAGCATGGATGAAAAT[A/T]AAGCCCCAGTCACATATTACCTCTATGTCCAGCATAACGGCATGGTAATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7498
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111824 Missense 326 463 7 9
Genomic Location (Zv9):
Chromosome 22 (position 38255913)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 35404334
KASP Assay ID:
554-4335.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTTTGCACTGATGGTGGCCAGTCTTCTGGAGACCATTTTTATCATAAATA[T/C]TCTGTGTGGCTCCGTTAACTATGGACCATTGCCYCGATGGGTCAARGTGC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link