rnf6

Ensembl ID:
ENSDARG00000077955
ZFIN ID:
ZDB-GENE-100209-1
Description:
Putative uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:B4F6Q6]
Human Orthologue:
RNF6
Human Description:
ring finger protein (C3H2C3 type) 6 [Source:HGNC Symbol;Acc:10069]
Mouse Orthologue:
Rnf6
Mouse Description:
ring finger protein (C3H2C3 type) 6 Gene [Source:MGI Symbol;Acc:MGI:1921382]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa6766 Nonsense Mutation detected in F1 DNA During 2014
sa15269 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa6766
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109587 Nonsense 333 713 4 4
Genomic Location:
Chromosome 24 (position 22113308)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGTTCAGCCTCAGTCTGACCCCCAGGTGGCGCCAGCTGCCCGTGAGCCA[C/T]GAAACAGTAGGACTCGTTCACGTGGTCGTGTGCGCCGGGCAGCAGGTGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15269
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109587 Nonsense 641 713 4 4
Genomic Location:
Chromosome 24 (position 22112384)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCTCAATGAAGATGAAGAYGAGGAGCACCCACGGGGCCTCACCAAAGAA[C/T]AGATCGACAATCTGGTCACACGCACTTACGGTCAGGTCAACCTGGAGGGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/99fydxpg