ENSDARG00000077954

Ensembl ID:
ENSDARG00000077954

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa25353 Essential Splice Site Mutation detected in F1 DNA During 2016
sa481 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa25353
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114789 Essential Splice Site 46 347 1 6
Genomic Location (Zv9):
Chromosome 7 (position 9142619)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 8089984
KASP Assay ID:
554-7325.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCAGCTGGTGATGAAACTAGAGGTACAAGAACGTGAAGGGGAAGAAAAA[G/A]TGGATGAACTTCAAATGAAGCTGCTGGAAGTGGAACGATTGGGTGCATTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa481
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114789 Essential Splice Site 47 347 2 6
Genomic Location (Zv9):
Chromosome 7 (position 9143899)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 8091264
KASP Assay ID:
554-0308.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGAAATGTAAAAACAACATGCTATCAAACATTGAGGAAAGTGCTGCTCA[G/T]ATGAAGCGTTTAGAGGAAGAATTAAAAATAAAAGAGGAGGAAATCACTCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link