ENSDARG00000077954

Ensembl ID:
ENSDARG00000077954

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa25353 Essential Splice Site Mutation detected in F1 DNA During 2014
sa481 Essential Splice Site Available for shipment Available now
sa8258 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa25353
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114789 Essential Splice Site 46 347 1 6
Genomic Location:
Chromosome 7 (position 9142619)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCAGCTGGTGATGAAACTAGAGGTACAAGAACGTGAAGGGGAAGAAAAA[G/A]TGGATGAACTTCAAATGAAGCTGCTGGAAGTGGAACGATTGGGTGCATTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa481
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114789 Essential Splice Site 47 347 2 6
Genomic Location:
Chromosome 7 (position 9143899)
KASP Assay ID:
554-0308.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGAAATGTAAAAACAACATGCTATCAAACATTGAGGAAAGTGCTGCTCA[G/T]ATGAAGCGTTTAGAGGAAGAATTAAAAATAAAAGAGGAGGAAATCACTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8258
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114789 Nonsense 319 347 6 6
Genomic Location:
Chromosome 7 (position 9145886)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAATAAATGAAAAGCAGGAGATGGAGGTGCAAGTGTACAGGATTAGAGAA[G/T]ARGAGAAGAATCTGGAAAATGAGAGTGAGAATAACAAACGCCTGGCTGAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/m94mc1ho