usp54a

Ensembl ID:
ENSDARG00000077948
ZFIN ID:
ZDB-GENE-090828-2
Human Orthologue:
USP54
Human Description:
ubiquitin specific peptidase 54 [Source:HGNC Symbol;Acc:23513]
Mouse Orthologue:
Usp54
Mouse Description:
ubiquitin specific peptidase 54 Gene [Source:MGI Symbol;Acc:MGI:1926037]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa35469 Nonsense Available for shipment Available now
sa12838 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa35469
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110794 Nonsense 946 1497 17 21
Genomic Location (Zv9):
Chromosome 13 (position 22505095)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 22234433
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTCCCAGAAGGACAATACAGGGGACCACCCTAGTTCTCTTGATGTGACA[G/T]AAAATGATCGGGGTCCTAGGGACCTTGTAATTAACACAAACTCTCTTGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12838
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110794 Nonsense 1105 1497 17 21
Genomic Location (Zv9):
Chromosome 13 (position 22505574)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 22234912
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCCGGCCCCATGCCTGTGGAACGTTGGGCAGAGAATGTCAATCRATACTA[C/A]AATTCCCAGAAGTGTGCGCGGTCGGGACGTGACTCGCCYTGYGAGGAGCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link