LOC564642

Ensembl ID:
ENSDARG00000077943
Human Orthologue:
INTS5
Human Description:
integrator complex subunit 5 [Source:HGNC Symbol;Acc:29352]
Mouse Orthologue:
Ints5
Mouse Description:
integrator complex subunit 5 Gene [Source:MGI Symbol;Acc:MGI:1923578]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22540 Nonsense Available for shipment Available now
sa19097 Nonsense Mutation detected in F1 DNA During 2016
sa35755 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa22540
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111134 Nonsense 68 985 1 6
Genomic Location:
Chromosome 14 (position 48490673)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTTAAGGGGAGTGTATGATGAATACGTTGCTTCCTTTCTACAGGACCTG[G/T]AGGCAGAGGGTGAAAATGGTGGTAACAGTGCAAGTGGAGGAGCCAGCGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19097
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111134 Nonsense 392 985 2 6
Genomic Location:
Chromosome 14 (position 48489674)
KASP Assay ID:
2260-7894.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATCAGGTCCTACACCCTCTCCCCATGATGGTATTCGAGAGGCCTGTGAC[C/T]GATTACTGCAAATGCTTCTGCTGCATCTTCACAAACTGGTGCACAACCGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35755
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111134 Nonsense 723 985 4 6
Genomic Location:
Chromosome 14 (position 48488626)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTCCACGCTGGAATAATCGGAAAGGGTTTGAAGCCTCCATATACTCCCT[T/A]ACATCCTGACCCAGATCGAGTCAGTCAGAATATGCAGACCTTGCTTGCGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link