LOC564642

Ensembl ID:
ENSDARG00000077943
Human Orthologue:
INTS5
Human Description:
integrator complex subunit 5 [Source:HGNC Symbol;Acc:29352]
Mouse Orthologue:
Ints5
Mouse Description:
integrator complex subunit 5 Gene [Source:MGI Symbol;Acc:MGI:1923578]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22540 Nonsense Mutation detected in F1 DNA During 2014
sa19097 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa22540
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111134 Nonsense 68 985 1 6
Genomic Location:
Chromosome 14 (position 48490673)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTTAAGGGGAGTGTATGATGAATACGTTGCTTCCTTTCTACAGGACCTG[G/T]AGGCAGAGGGTGAAAATGGTGGTAACAGTGCAAGTGGAGGAGCCAGCGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19097
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111134 Nonsense 392 985 2 6
Genomic Location:
Chromosome 14 (position 48489674)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATCAGGTCCTACACCCTCTCCCCATGATGGTATTCGAGAGGCCTGTGAC[C/T]GATTACTGCAAATGCTTCTGCTGCATCTTCACAAACTGGTGCACAACCGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/x6btg2bl