tegt

Ensembl ID:
ENSDARG00000077934
ZFIN ID:
ZDB-GENE-030826-10
Human Orthologue:
TMBIM6
Human Description:
transmembrane BAX inhibitor motif containing 6 [Source:HGNC Symbol;Acc:11723]
Mouse Orthologue:
Tmbim6
Mouse Description:
transmembrane BAX inhibitor motif containing 6 Gene [Source:MGI Symbol;Acc:MGI:99682]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa11859 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa11859
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108703 Nonsense 69 236 3 9
Genomic Location:
Chromosome 11 (position 213013)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCTGCTCAGGGTGGTCTGACCATGCTGGGCTCTCTGGCCATGATGGCGTG[G/A]CTSGCCATGACGCCTCACAGCCCRCAGACAGAGAAGAAGAGRCTGGCCAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/lr44g4cz