ENSDARG00000077920

Ensembl ID:
ENSDARG00000077920
Human Orthologues:
CSMD1, CSMD2, CSMD3
Human Descriptions:
CUB and Sushi multiple domains 1 [Source:HGNC Symbol;Acc:14026]
CUB and Sushi multiple domains 2 [Source:HGNC Symbol;Acc:19290]
CUB and Sushi multiple domains 3 [Source:HGNC Symbol;Acc:19291]
Mouse Orthologues:
Csmd1, Csmd2, Csmd3
Mouse Descriptions:
CUB and Sushi multiple domains 1 Gene [Source:MGI Symbol;Acc:MGI:2137383]
CUB and Sushi multiple domains 2 Gene [Source:MGI Symbol;Acc:MGI:2386401]
CUB and Sushi multiple domains 3 Gene [Source:MGI Symbol;Acc:MGI:2386403]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa4822 Nonsense Mutation detected in F1 DNA During 2014
sa9544 Nonsense Available for shipment Available now
sa23599 Nonsense Mutation detected in F1 DNA During 2014
sa12387 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa4822
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108507 Nonsense 1096 1873 21 35
Genomic Location:
Chromosome 19 (position 46021797)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATCCAGGTGTGCCGCATTACGGGCGGCGTAACGGATACAGCTTCGGTATC[G/T]GAGACACTCTGACCTTCTCCTGCAATCTGGGCTACCGTCTGGAGGGAGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9544
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108507 Nonsense 1442 1873 27 35
Genomic Location:
Chromosome 19 (position 45951766)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATCCTGGAGTCCCGATGAATGGCAGTCGTAATGGAGACGGTCGTGAGCCT[G/T]GAGACACAGTGACCTTCCAGTGTGATCCTGGATATGAACTTCAGGGAGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23599
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108507 Nonsense 1453 1873 27 35
Genomic Location:
Chromosome 19 (position 45951731)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GACGGTCGTGAGCCTGGAGACACAGTGACCTTCCAGTGTGATCCTGGATA[T/G]GAACTTCAGGGAGACGTGAAGATCACCTGCATCCAGGTGGAAAACCGCTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12387
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108507 Nonsense 1762 1873 33 35
Genomic Location:
Chromosome 19 (position 45887616)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGTTCAGTAYAGTTGGACCAGAGACGGCCAAAGGCTTTCATTTTGTGTA[T/G]CAAGGTCAGTTTYTAGCTCTGTCAGAAATCTGTATGCTTATTCTATTTAC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ra7cwsoz