LOC562996

Ensembl ID:
ENSDARG00000077918
Human Orthologue:
DNASE2B
Human Description:
deoxyribonuclease II beta [Source:HGNC Symbol;Acc:28875]
Mouse Orthologue:
Dnase2b
Mouse Description:
deoxyribonuclease II beta Gene [Source:MGI Symbol;Acc:MGI:1913283]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa21851 Splice Site, Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa21851
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112127 Splice Site, Nonsense 39 354 2 7
Genomic Location:
Chromosome 11 (position 8317336)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTATATGCAATGATGTCTATCAGCATTGTAATTCTGCAATCTTCTAAAAG[G/A]TTTATTATGTACAAACTTCCCATTTACAAGATGGAGGTTAAGGGAAGCGG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/9acc6bao