ENSDARG00000077915

Ensembl ID:
ENSDARG00000077915
Human Orthologues:
LMX1A, LMX1B
Human Descriptions:
LIM homeobox transcription factor 1, alpha [Source:HGNC Symbol;Acc:6653]
LIM homeobox transcription factor 1, beta [Source:HGNC Symbol;Acc:6654]
Mouse Orthologues:
Lmx1a, Lmx1b
Mouse Descriptions:
LIM homeobox transcription factor 1 alpha Gene [Source:MGI Symbol;Acc:MGI:1888519]
LIM homeobox transcription factor 1 beta Gene [Source:MGI Symbol;Acc:MGI:1100513]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa2106 Nonsense F2 line generated During 2014

Mutation Details

Allele Name:
sa2106
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098826 Nonsense 50 303 2 8
Genomic Location:
Chromosome 3 (position 53506437)
KASP Assay ID:
554-2914.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGCGCGTGTCTGCAGGCGATCGGCCGCTCAGAGCTCATCATGCGAGTGT[T/A]GGGACAGGTGTATCACCTGGGCTGCTTCAGCTGCTGCGAGTGTGAGCGCC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/oywz41kq