LOC792710

Ensembl ID:
ENSDARG00000077912
Human Orthologue:
BCORL1
Human Description:
BCL6 corepressor-like 1 [Source:HGNC Symbol;Acc:25657]
Mouse Orthologue:
Bcorl1
Mouse Description:
BCL6 co-repressor-like 1 Gene [Source:MGI Symbol;Acc:MGI:2443910]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12386 Nonsense Available for shipment Available now
sa35746 Nonsense Mutation detected in F1 DNA During 2016
sa35747 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa12386
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111480 Nonsense 538 1514 2 11
Genomic Location:
Chromosome 14 (position 42949061)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGAAAGCTTTCAACAGGTACTCARCAAGGTTTTTTATCCACCCAATTATG[T/A]GCTACAGTAAATTCACAGCCCCACCGAAAGTCTGTTGGTGGAAAAGGAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35746
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111480 Nonsense 1028 1514 4 11
Genomic Location:
Chromosome 14 (position 42958031)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGAGACACCTCTTCAATAAAGAAAAGGAAACGCTGCAAGAATCGTAAATA[T/A]CAGAACGGGGAATACATCACCGAGAAGGATAAGGTGGCAGATGGAGAGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35747
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111480 Nonsense 1291 1514 8 11
Genomic Location:
Chromosome 14 (position 42967323)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATTCATGATGCAGTAGCAGCTGATAATCTGCCGGCTGTCTGGATGTTGT[T/A]AAATCACGGAGCAGACCCAACGCTGGCCACCTACTCTGGTCAGACCGCAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link