treh

Ensembl ID:
ENSDARG00000077911
ZFIN ID:
ZDB-GENE-070912-84
Human Orthologue:
TREH
Human Description:
trehalase (brush-border membrane glycoprotein) [Source:HGNC Symbol;Acc:12266]
Mouse Orthologue:
Treh
Mouse Description:
trehalase (brush-border membrane glycoprotein) Gene [Source:MGI Symbol;Acc:MGI:1926230]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa23369 Essential Splice Site Available for shipment Available now
sa6532 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa23369
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111309 Essential Splice Site 206 583 6 17
Genomic Location:
Chromosome 18 (position 42261023)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGAGACAGCCAGAGGAATGATTCTCAACTTTGTGTACTTGGTAGAAAGG[T/C]GCTTTCATTGTCTCCTATTTTAAAATGCTTGCAGACATAGAGAGCCCCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6532
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111309 Nonsense 255 583 8 17
Genomic Location:
Chromosome 18 (position 42259635)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCATGTGCTCGGTGGTTCAGGCAGGTTTTGCCAGCRCTGGAAAGAGAGTA[C/A]AGCTTTTGGATGCAGAATCGGTCGGTTGAYGTGRTGACGAGTGAACTGAC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Height: Hundreds of variants clustered in genomic loci and biological pathways affect human height. (View Study)
  • Vitiligo: Association analyses identify three susceptibility Loci for vitiligo in the Chinese Han population. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/wm5sop8n