ENSDARG00000077910

Ensembl ID:
ENSDARG00000077910

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20998 Essential Splice Site Available for shipment Available now
sa17151 Essential Splice Site Available for shipment Available now
sa10995 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa20998
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058095 Essential Splice Site 7 326 2 9
Genomic Location:
Chromosome 7 (position 35930404)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAAACTATATTTTTTCATGGCAAGGTTGACATTTACATGGAATTGCTCTT[A/G]TACCAACCCACTTGCATTGTGGTCAGTGGGTGTCAAAGAAAGGTAAACAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17151
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058095 Essential Splice Site 134 326 6 9
ENSDART00000058095 Essential Splice Site 134 326 6 9
Genomic Location:
Chromosome 7 (position 35929591)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGATCCAGTAGAGCCGCAGGAAGCAATCCCTGATGCACAGAGCTTTAAA[G/T]TGWGTAGTACTTTAATTTATTTTCATTATGAAGTATTTGTTTACAATGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10995
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058095 Essential Splice Site 134 326 6 9
ENSDART00000058095 Essential Splice Site 134 326 6 9
Genomic Location:
Chromosome 7 (position 35929591)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGATCCAGTAGAGCCGCAGGAAGCAATCCCTGATGCACAGAGCTTTAAA[G/T]TGAGTAGTACTTTAATTTATTTTCATTATGAAGTATTTGTTTACAATGCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/gpwt89fg