si:dkey-183p4.10

Ensembl ID:
ENSDARG00000077907
ZFIN ID:
ZDB-GENE-081104-337
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:B8JIR9]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa27207 Essential Splice Site Mutation detected in F1 DNA During 2017
sa41211 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa27207
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111248 Essential Splice Site 898 945 7 8
ENSDART00000140965   None 256 None 2
ENSDART00000144835   None 250 None 6
Genomic Location (Zv9):
Chromosome 8 (position 26216969)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 25344887
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTTACAAAGGGCAGACAAGCAGCTGAAGGAACCGCGCAAGAGAAATAAG[G/A]TAAATATTAAACTGAAAGATTAAAAAAGAAAAAGTTTGACCAAAAATAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41211
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111248 Nonsense 944 945 8 8
ENSDART00000140965   None 256 None 2
ENSDART00000144835   None 250 None 6
Genomic Location (Zv9):
Chromosome 8 (position 26219730)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 25347648
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGACTTACTGAATACACATGTATCTTCCGTATTCAACATGATTCAAAAC[A/T]GACAATAAAAGTTTTGCATGCATGCATATACGTAACTATTGCATAGGACC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link