CSMD3 (1 of 2)

Ensembl ID:
ENSDARG00000077905
Description:
CUB and Sushi multiple domains 3 [Source:HGNC Symbol;Acc:19291]
Human Orthologue:
CSMD3
Human Description:
CUB and Sushi multiple domains 3 [Source:HGNC Symbol;Acc:19291]
Mouse Orthologue:
Csmd3
Mouse Description:
CUB and Sushi multiple domains 3 Gene [Source:MGI Symbol;Acc:MGI:2386403]

Alleles

There are 8 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17498 Nonsense Available for shipment Available now
sa16830 Essential Splice Site Available for shipment Available now
sa22951 Missense Mutation detected in F1 DNA During 2014
sa19154 Essential Splice Site Mutation detected in F1 DNA During 2014
sa8930 Nonsense Mutation detected in F1 DNA During 2014
sa22950 Essential Splice Site Mutation detected in F1 DNA During 2014
sa22949 Nonsense Mutation detected in F1 DNA During 2014
sa9590 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa17498
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006458 Nonsense 111 2896 3 60
Genomic Location:
Chromosome 16 (position 51167151)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGCCTGATTTTTTTTCTTCTTTTTTTGTTTTGTTTCCTGAGCARTGAAA[C/T]GATCTGGGGATTTTAAGTCAAGAGGAGTCAAATTAYTACCTGGAAAAGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16830
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006458 Essential Splice Site 1009 2896 19 60
Genomic Location:
Chromosome 16 (position 51083292)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TATTCTGACCAAGAGGACACGGCTGAGGGATTCAAGCTTGCTTACACTAG[T/A]AAGATTCCTCTTGCTCTCACTTTCTTCCACACCGCTNNNNNNNNNNNACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22951
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006458 Missense 1597 2896 30 60
Genomic Location:
Chromosome 16 (position 50989486)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGCAGTGCCCAACTCACTCGCCCAGTGGAACGGCACTGTGCCAGCATGT[G/A]TCGGTATGTCCACCCACACACACACACAAATACAAATCTGTCTGCTCAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19154
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006458 Essential Splice Site 1633 2896 32 60
Genomic Location:
Chromosome 16 (position 50968318)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATATATATTTATATCTTCCTAAAAACATTCAAAATCATGATTAGTTCCA[G/T]TGAGTTTGGTTACTTAACGCTTGCCAAGAGATAATAATTGTATCAAGGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8930
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006458 Nonsense 1879 2896 42 60
Genomic Location:
Chromosome 16 (position 50940289)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCTTTCACAGCGACTACTCCCAGAACAAACCCGGCTTCCACATCACCTA[C/A]GAGGGTAAGACGGRTTAGACCTGCCCTCAGCCATTACTTCCCCTGTCCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22950
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006458 Essential Splice Site 1881 2896 43 60
Genomic Location:
Chromosome 16 (position 50936932)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTCTTTTTCTTTGTTGTTTATCACTTCTTAAAACCAACTGTTTTTCTTC[G/A]ACCATCCAGCCTATGAACTGCAGAGGTGTCCGGATCCACGGCCCTTTCGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22949
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006458 Nonsense 1938 2896 43 60
Genomic Location:
Chromosome 16 (position 50936759)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGCTGGGTGAATCGTCGCTCACCTGTCTGCATGGTGTCAGCCGAAACTG[G/A]AACCATCCTGTGCCTCGCTGTGAAGGTATACTTATCAAAAAATGTACCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9590
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006458 Nonsense 2703 2896 57 60
Genomic Location:
Chromosome 16 (position 50865044)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACAGGTGTTTAGAAGACAGAGTTTTGATTGGTGAATCCACCCGAGCCTGC[C/T]AACTRAACGGCCAGTGGGGTGGCTCGCAACCTCATTGCTCAGGTAAGATG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/3ercjgp7