LOC569603

Ensembl ID:
ENSDARG00000077901
Human Orthologue:
HERC1
Human Description:
hect (homologous to the E6-AP (UBE3A) carboxyl terminus) domain and RCC1 (CHC1)-like domain (RLD) 1
Mouse Orthologue:
Herc1
Mouse Description:
hect (homologous to the E6-AP (UBE3A) carboxyl terminus) domain and RCC1 (CHC1)-like domain (RLD) 1

Alleles

There are 7 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14578 Essential Splice Site Available for shipment Available now
sa20959 Nonsense Mutation detected in F1 DNA During 2014
sa25364 Nonsense Mutation detected in F1 DNA During 2014
sa7596 Missense Mutation detected in F1 DNA During 2014
sa5422 Nonsense Mutation detected in F1 DNA During 2014
sa14254 Essential Splice Site Available for shipment Available now
sa18872 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa14578
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109030 Essential Splice Site 337 4852 2 77
Genomic Location:
Chromosome 7 (position 30607116)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGATGGCCTTTGTTCCTTATATGAAGCTGCACTTTGCCTGTTTGAGGAGG[T/G]AACATGGTTATAAATATGTAAAACAACTGTATAAAAACANNATTTTATTTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20959
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109030 Nonsense 984 4852 14 77
Genomic Location:
Chromosome 7 (position 30592669)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCATCTGATAGCAGCCAACCAGCACACCTCCATGAACTGCTCTGCTCTT[T/A]GCAGAAACAACTGCTGGCCTATTGCCACATCAACAGTGTTACAGAGGTAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25364
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109030 Nonsense 1125 4852 17 77
Genomic Location:
Chromosome 7 (position 30588916)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTCCGGATCTGGTTGATCCAGTGTGTGTGTCAGGACCGGCACAGAGCTG[G/A]GTGTGGTTGGTGGATCTGGAGCGCACCGCAGCTCTGCTGGTGGGACGTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7596
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109030 Missense 1412 4852 22 77
Genomic Location:
Chromosome 7 (position 30582312)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCGGAAGCATGAGCGTGCAGGAAGAGCCTCCTCAGCCTGGTCCAGAGCGA[C/T]GCAACAGCWCGACCCCTCAGGAGGGACAGGATCTTTACACCACCTCCTGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5422
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109030 Nonsense 1550 4852 25 77
Genomic Location:
Chromosome 7 (position 30576686)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GACTCTTCTGCTGACTGGTTTGGGGGACGCTTGGCCCGCGAGTGTTTCTA[C/A]AGCTCTCAACAGTCCTATGATGAGTCAGACCTCGATCTGAACCAATCACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14254
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109030 Essential Splice Site 1730 4852 27 77
Genomic Location:
Chromosome 7 (position 30575957)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGTCAGTCACATTAGAAAGAGCCCTGCAAGCAAACAAACACCACATAGG[T/C]AATGGACTCAAACTCATACACTGYTTTGATTCAGGTACCATTTGCTATTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18872
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109030 Essential Splice Site 4689 4852 75 77
Genomic Location:
Chromosome 7 (position 30529156)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTATGTAGAGCGGGCCATCGAGTATCGACTCCATGAAATGGATCGTCAGG[T/G]GTGTTAAGCTCAACAATGAACACAAAGGTGTGTATTCAGTGAGAGGTCAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Iris characteristics: GWAS findings for human iris patterns: associations with variants in genes that influence normal neuronal pattern development. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ehh6o0tx