LOC796777

Ensembl ID:
ENSDARG00000077893
Human Orthologue:
ELFN2
Human Description:
extracellular leucine-rich repeat and fibronectin type III domain containing 2 [Source:HGNC Symbol;A
Mouse Orthologue:
Elfn2
Mouse Description:
leucine rich repeat and fibronectin type III, extracellular 2 Gene [Source:MGI Symbol;Acc:MGI:360841

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa8536 Nonsense Mutation detected in F1 DNA During 2016
sa40104 Nonsense Mutation detected in F1 DNA During 2016
sa20060 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa8536
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111631 Nonsense 279 857 1 3
Genomic Location (Zv9):
Chromosome 3 (position 33706539)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 33440707
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTCWTCRGGCATGGAGCCTGGCATGTTTGAGCCCATTGGAYCATACCAT[C/T]AGCCCACAACTTCCTCGTCGTCAGATAAACCGTTTAGTCCCAGCATCAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40104
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111631 Nonsense 316 857 1 3
Genomic Location (Zv9):
Chromosome 3 (position 33706428)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 33440596
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTCCCTTTCCGCTGCATCTCTTCTGATCCAGATTCCAAATCCATACAGC[A/T]AAATGTACATCCTGGTACAGTACAATCAGAGCTTTGTGTCAGATGTGATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20060
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111631 Nonsense 423 857 1 3
Genomic Location (Zv9):
Chromosome 3 (position 33706107)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 33440275
KASP Assay ID:
2259-3712.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCTTGGGTTTGTCTACTATTGCTTGCGAAGGCGTCGCCGTCAAGAAGAG[A/T]AAGAAAAATCCATCTGCGTGAAAAAGACTATTCTGGAAATGCGTTATGGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link