LOC796777

Ensembl ID:
ENSDARG00000077893
Human Orthologue:
ELFN2
Human Description:
extracellular leucine-rich repeat and fibronectin type III domain containing 2 [Source:HGNC Symbol;A
Mouse Orthologue:
Elfn2
Mouse Description:
leucine rich repeat and fibronectin type III, extracellular 2 Gene [Source:MGI Symbol;Acc:MGI:360841

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa8536 Nonsense Mutation detected in F1 DNA During 2014
sa20060 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa8536
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111631 Nonsense 279 857 1 3
Genomic Location:
Chromosome 3 (position 33706539)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTCWTCRGGCATGGAGCCTGGCATGTTTGAGCCCATTGGAYCATACCAT[C/T]AGCCCACAACTTCCTCGTCGTCAGATAAACCGTTTAGTCCCAGCATCAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20060
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111631 Nonsense 423 857 1 3
Genomic Location:
Chromosome 3 (position 33706107)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCTTGGGTTTGTCTACTATTGCTTGCGAAGGCGTCGCCGTCAAGAAGAG[A/T]AAGAAAAATCCATCTGCGTGAAAAAGACTATTCTGGAAATGCGTTATGGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ykqm80pe