NPC1L1

Ensembl ID:
ENSDARG00000077891
Description:
NPC1 (Niemann-Pick disease, type C1, gene)-like 1 [Source:HGNC Symbol;Acc:7898]
Human Orthologue:
NPC1L1
Human Description:
NPC1 (Niemann-Pick disease, type C1, gene)-like 1 [Source:HGNC Symbol;Acc:7898]
Mouse Orthologue:
Npc1l1
Mouse Description:
NPC1-like 1 Gene [Source:MGI Symbol;Acc:MGI:2685089]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa74 Missense Confirmed mutation in F2 line During 2017
sa19867 Nonsense Mutation detected in F1 DNA During 2017
sa19868 Nonsense Available for shipment Available now
sa6862 Essential Splice Site Mutation detected in F1 DNA During 2017
sa16090 Essential Splice Site Available for shipment Available now
sa10849 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa74
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064027 Missense 99 1081 1 15
Genomic Location (Zv9):
Chromosome 2 (position 46965353)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 40512773
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCGTTCTGATCCGCTGCCCGTCCTGTGCCGAGAACTTTGCGTATCTCCAT[T/C]GCGCCACGACCTGCAGTCCTGACCAAAGTCAGATATTGAAGATCACCAAA
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa19867
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064027 Nonsense 111 1081 1 15
Genomic Location (Zv9):
Chromosome 2 (position 46965390)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 40512736
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCGTATCTCCATTGCGCCACGACCTGCAGTCCTGACCAAAGTCAGATAT[T/A]GAAGATCACCAAAACGGCCAACATCACTCAACCCACAGGCATTGTAAAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19868
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064027 Nonsense 240 1081 1 15
Genomic Location (Zv9):
Chromosome 2 (position 46965776)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 40512350
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGAAGTCACACCTTCCGGTGGCGAGGCCTGTTCCTGTCAGGACTGCCTA[C/T]AATCTTGTCCGGTGGTGCCAGAACCACCGCCTCTGCCGAAACCCTTCATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6862
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064027 Essential Splice Site 318 1081 2 15
Genomic Location (Zv9):
Chromosome 2 (position 46966047)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 40512079
KASP Assay ID:
554-5403.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AATCAGCCCTAAAGATGTTTCGTGCTCTGACAAAGCCAGTCTTGCCACTC[A/G]GGAATTCCTAGGGTCTCTTTTCCAGTCCTGGGGGACCTTAATGGCACGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16090
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064027 Essential Splice Site 422 1081 3 15
Genomic Location (Zv9):
Chromosome 2 (position 46969093)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 40509415
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AATATAAGATTTCAGTCATTTTAAATATATTGTGMATGTTTCTACCTTGC[A/C]GATTTGATCATAGAGCTGTTRAAGCTTCAGCAGAGCATCCAAGCAATTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10849
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064027 Nonsense 1008 1081 13 15
Genomic Location (Zv9):
Chromosome 2 (position 46984922)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 40493614
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCAACAGATTTCTGCCAGATTTTCTGAGCAACAGACCTGACCTGCAGTG[T/A]CCAAAAGGGTAAGAAAAGCAAATTAATTAAGTCTGAACCAACTGAACACT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link