chl1a

Ensembl ID:: ENSDARG00000077881
ZFIN ID:: ZDB-GENE-090313-201
Description:: cell adhesion molecule with homology to L1CAM (close homolog of L1) a [Source:RefSeq peptide;Acc:NP
Human Orthologue:: CHL1
Human Description:: cell adhesion molecule with homology to L1CAM (close homolog of L1) [Source:HGNC Symbol;Acc:1939]
Mouse Orthologue:: Chl1
Mouse Description:: cell adhesion molecule with homology to L1CAM Gene [Source:MGI Symbol;Acc:MGI:1098266]

Alleles

There are 4 alleles of this gene:

Allele name	Consequence	Status	Availability Estimate
sa6728	Essential Splice Site	Mutation detected in F1 DNA	During 2015
sa18253	Nonsense	Available for shipment	Available now
sa14749	Essential Splice Site	Available for shipment	Available now
sa9665	Nonsense	Available for shipment	Available now

Mutation Details

Allele Name:: sa6728
Current Status:: Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:: We currently estimate that this allele will be available during 2015.
Mutation:: T > C
Consequence:: Essential Splice Site

Transcript ID	Consequence	Amino Acid Affected	Amino Acid Total	Exon Affected	Exon Total
ENSDART00000111028	Essential Splice Site	128	1153	3	27
ENSDART00000113516	Essential Splice Site	128	1153	3	26
ENSDART00000135406	Essential Splice Site	128	1153	4	26

The following transcripts of ENSDARG00000077881 do not overlap with this mutation:

ENSDART00000131996

Genomic Location:: Chromosome 23 (position 11487575)
KASP Assay ID:: None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:: AACAAACTCGGAACTRCAACTTCAGAAGAAGCCGAATTTATTGTGCCTAG[T/C]AAGTCATAGTTCNNAYATATATATCACTCATTGTCTTGGCTTCTTAACTTGA
Associated Phenotype:: Not determined

Mutation Details

Allele Name:: sa18253
Current Status:: Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:: C > A
Consequence:: Nonsense

Transcript ID	Consequence	Amino Acid Affected	Amino Acid Total	Exon Affected	Exon Total
ENSDART00000111028	Nonsense	188	1153	5	27
ENSDART00000113516	Nonsense	188	1153	5	26
ENSDART00000135406	Nonsense	188	1153	6	26

The following transcripts of ENSDARG00000077881 do not overlap with this mutation:

ENSDART00000131996

Genomic Location:: Chromosome 23 (position 11493468)
KASP Assay ID:: None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:: CACATTGAGCAGAATGAGAGGGTGTCCATGGGCCTCAGTGGGAATCTGTA[C/A]TTCTCTAATAMGCTGGTGTCAGRCAGTCATGATGACTACTGCTGCTTYGC
Associated Phenotype:: Not determined

Mutation Details

Allele Name:: sa14749
Current Status:: Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:: T > A
Consequence:: Essential Splice Site

Transcript ID	Consequence	Amino Acid Affected	Amino Acid Total	Exon Affected	Exon Total
ENSDART00000111028	Essential Splice Site	332	1153	8	27
ENSDART00000113516	Essential Splice Site	332	1153	8	26
ENSDART00000135406	Essential Splice Site	332	1153	9	26

The following transcripts of ENSDARG00000077881 do not overlap with this mutation:

ENSDART00000131996

Genomic Location:: Chromosome 23 (position 11497920)
KASP Assay ID:: None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:: MAGAATCAGCATGGTGAAGATGTGCATCATTTCCAGGTCGAAGTAGARGG[T/A]AAGCTAACATTYACAAGGTYTTTAACCTGAATTTTACTCTGGTATTTGAG
Associated Phenotype:: Not determined

Mutation Details

Allele Name:: sa9665
Current Status:: Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:: A > T
Consequence:: Nonsense

Transcript ID	Consequence	Amino Acid Affected	Amino Acid Total	Exon Affected	Exon Total
ENSDART00000111028	Nonsense	369	1153	9	27
ENSDART00000113516	Nonsense	369	1153	9	26
ENSDART00000135406	Nonsense	369	1153	10	26

The following transcripts of ENSDARG00000077881 do not overlap with this mutation:

ENSDART00000131996

Genomic Location:: Chromosome 23 (position 11498736)
KASP Assay ID:: None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:: TCCACATCAACTGTTCTGCTACCGGAAAACCGCAACCCACAATCACCTGG[A/T]AAAGAAACGGCAAGCCCCTCGATGGTGTGTTRAACCCCCTCCTCTCAACC
Associated Phenotype:: Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

Fasting insulin-related traits (interaction with BMI): A genome-wide approach accounting for body mass index identifies genetic variants influencing fasting glycemic traits and insulin resistance. (View Study)
Obesity-related traits: Novel genetic loci identified for the pathophysiology of childhood obesity in the Hispanic population. (View Study)
Prostate cancer (gene x gene interaction): A genome-wide search for loci interacting with known prostate cancer risk-associated genetic variants. (View Study)
Response to antidepressant treatment: Pharmacogenomic study of side-effects for antidepressant treatment options in STAR*D. (View Study)
Response to statin therapy: Genome-wide association of lipid-lowering response to statins in combined study populations. (View Study)
Scoliosis: Genome-wide association studies of adolescent idiopathic scoliosis suggest candidate susceptibility genes. (View Study)
Sudden cardiac arrest: GWAS for discovery and replication of genetic loci associated with sudden cardiac arrest in patients with coronary artery disease. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

OMIM

OMIM information for CHL1

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: