
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
chl1a
- Ensembl ID:
- ENSDARG00000077881
- ZFIN ID:
- ZDB-GENE-090313-201
- Description:
- cell adhesion molecule with homology to L1CAM (close homolog of L1) a [Source:RefSeq peptide;Acc:NP
- Human Orthologue:
- CHL1
- Human Description:
- cell adhesion molecule with homology to L1CAM (close homolog of L1) [Source:HGNC Symbol;Acc:1939]
- Mouse Orthologue:
- Chl1
- Mouse Description:
- cell adhesion molecule with homology to L1CAM Gene [Source:MGI Symbol;Acc:MGI:1098266]
Alleles
There are 4 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa6728 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
sa18253 | Nonsense | Available for shipment | Available now |
sa14749 | Essential Splice Site | Available for shipment | Available now |
sa9665 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa6728
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > C
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000111028 | Essential Splice Site | 128 | 1153 | 3 | 27 |
ENSDART00000113516 | Essential Splice Site | 128 | 1153 | 3 | 26 |
ENSDART00000135406 | Essential Splice Site | 128 | 1153 | 4 | 26 |
The following transcripts of ENSDARG00000077881 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 23 (position 11487575)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 23 11446377 GRCz11 23 11381347 - KASP Assay ID:
- 554-4867.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- AACAAACTCGGAACTRCAACTTCAGAAGAAGCCGAATTTATTGTGCCTAG[T/C]AAGTCATAGTTCNNAYATATATATCACTCATTGTCTTGGCTTCTTAACTTGA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa18253
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- C > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000111028 | Nonsense | 188 | 1153 | 5 | 27 |
ENSDART00000113516 | Nonsense | 188 | 1153 | 5 | 26 |
ENSDART00000135406 | Nonsense | 188 | 1153 | 6 | 26 |
The following transcripts of ENSDARG00000077881 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 23 (position 11493468)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 23 11452270 GRCz11 23 11387240 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- CACATTGAGCAGAATGAGAGGGTGTCCATGGGCCTCAGTGGGAATCTGTA[C/A]TTCTCTAATAMGCTGGTGTCAGRCAGTCATGATGACTACTGCTGCTTYGC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa14749
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- T > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000111028 | Essential Splice Site | 332 | 1153 | 8 | 27 |
ENSDART00000113516 | Essential Splice Site | 332 | 1153 | 8 | 26 |
ENSDART00000135406 | Essential Splice Site | 332 | 1153 | 9 | 26 |
The following transcripts of ENSDARG00000077881 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 23 (position 11497920)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 23 11456722 GRCz11 23 11391692 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- MAGAATCAGCATGGTGAAGATGTGCATCATTTCCAGGTCGAAGTAGARGG[T/A]AAGCTAACATTYACAAGGTYTTTAACCTGAATTTTACTCTGGTATTTGAG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa9665
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- A > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000111028 | Nonsense | 369 | 1153 | 9 | 27 |
ENSDART00000113516 | Nonsense | 369 | 1153 | 9 | 26 |
ENSDART00000135406 | Nonsense | 369 | 1153 | 10 | 26 |
The following transcripts of ENSDARG00000077881 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 23 (position 11498736)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 23 11457538 GRCz11 23 11392508 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TCCACATCAACTGTTCTGCTACCGGAAAACCGCAACCCACAATCACCTGG[A/T]AAAGAAACGGCAAGCCCCTCGATGGTGTGTTRAACCCCCTCCTCTCAACC
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Fasting insulin-related traits (interaction with BMI): A genome-wide approach accounting for body mass index identifies genetic variants influencing fasting glycemic traits and insulin resistance. (View Study)
- Obesity-related traits: Novel genetic loci identified for the pathophysiology of childhood obesity in the Hispanic population. (View Study)
- Prostate cancer (gene x gene interaction): A genome-wide search for loci interacting with known prostate cancer risk-associated genetic variants. (View Study)
- Response to antidepressant treatment: Pharmacogenomic study of side-effects for antidepressant treatment options in STAR*D. (View Study)
- Response to statin therapy: Genome-wide association of lipid-lowering response to statins in combined study populations. (View Study)
- Scoliosis: Genome-wide association studies of adolescent idiopathic scoliosis suggest candidate susceptibility genes. (View Study)
- Sudden cardiac arrest: GWAS for discovery and replication of genetic loci associated with sudden cardiac arrest in patients with coronary artery disease. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: