chl1a

Ensembl ID:
ENSDARG00000077881
ZFIN ID:
ZDB-GENE-090313-201
Description:
cell adhesion molecule with homology to L1CAM (close homolog of L1) a [Source:RefSeq peptide;Acc:NP
Human Orthologue:
CHL1
Human Description:
cell adhesion molecule with homology to L1CAM (close homolog of L1) [Source:HGNC Symbol;Acc:1939]
Mouse Orthologue:
Chl1
Mouse Description:
cell adhesion molecule with homology to L1CAM Gene [Source:MGI Symbol;Acc:MGI:1098266]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa6728 Essential Splice Site Mutation detected in F1 DNA During 2014
sa18253 Nonsense Available for shipment Available now
sa14749 Essential Splice Site Available for shipment Available now
sa9665 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa6728
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111028 Essential Splice Site 128 1153 3 27
ENSDART00000113516 Essential Splice Site 128 1153 3 26
ENSDART00000135406 Essential Splice Site 128 1153 4 26

The following transcripts of ENSDARG00000077881 do not overlap with this mutation:

Genomic Location:
Chromosome 23 (position 11487575)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AACAAACTCGGAACTRCAACTTCAGAAGAAGCCGAATTTATTGTGCCTAG[T/C]AAGTCATAGTTCNNAYATATATATCACTCATTGTCTTGGCTTCTTAACTTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18253
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111028 Nonsense 188 1153 5 27
ENSDART00000113516 Nonsense 188 1153 5 26
ENSDART00000135406 Nonsense 188 1153 6 26

The following transcripts of ENSDARG00000077881 do not overlap with this mutation:

Genomic Location:
Chromosome 23 (position 11493468)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CACATTGAGCAGAATGAGAGGGTGTCCATGGGCCTCAGTGGGAATCTGTA[C/A]TTCTCTAATAMGCTGGTGTCAGRCAGTCATGATGACTACTGCTGCTTYGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14749
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111028 Essential Splice Site 332 1153 8 27
ENSDART00000113516 Essential Splice Site 332 1153 8 26
ENSDART00000135406 Essential Splice Site 332 1153 9 26

The following transcripts of ENSDARG00000077881 do not overlap with this mutation:

Genomic Location:
Chromosome 23 (position 11497920)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
MAGAATCAGCATGGTGAAGATGTGCATCATTTCCAGGTCGAAGTAGARGG[T/A]AAGCTAACATTYACAAGGTYTTTAACCTGAATTTTACTCTGGTATTTGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9665
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111028 Nonsense 369 1153 9 27
ENSDART00000113516 Nonsense 369 1153 9 26
ENSDART00000135406 Nonsense 369 1153 10 26

The following transcripts of ENSDARG00000077881 do not overlap with this mutation:

Genomic Location:
Chromosome 23 (position 11498736)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCCACATCAACTGTTCTGCTACCGGAAAACCGCAACCCACAATCACCTGG[A/T]AAAGAAACGGCAAGCCCCTCGATGGTGTGTTRAACCCCCTCCTCTCAACC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/x3kots0d