Q1LUU0_DANRE

Ensembl ID:
ENSDARG00000077877
Description:
Zinc finger-like gene 1 [Source:UniProtKB/TrEMBL;Acc:Q1LUU0]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa23451 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa23451
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109156 Nonsense 449 505 1 1
ENSDART00000140332 Nonsense 417 473 1 1
Genomic Location (Zv9):
Chromosome 19 (position 10395564)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 9854103
KASP Assay ID:
2261-2984.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAATTGAGGATGAGCAAAAAGAACGTGAGTATATGGGATACTCAAAACTA[C/T]GAACTAAAGGAAGATGCAGGAATTGCAATGAAGAAGGACACTGGGCCCGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link