LOC100006895

Ensembl ID:
ENSDARG00000077872
Human Orthologue:
A2ML1
Human Description:
alpha-2-macroglobulin-like 1 [Source:HGNC Symbol;Acc:23336]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22629 Nonsense Available for shipment Available now
sa13829 Nonsense Available for shipment Available now
sa11423 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa22629
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033228 Nonsense 192 917 6 23
ENSDART00000038499 Nonsense 190 1434 6 34
Genomic Location (Zv9):
Chromosome 15 (position 20131501)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 21234127
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGTCAATGGACAAATGTTTCCTCAACAAGGTGGATTTTGCAGCGTTCATA[T/A]GAATTAAACCCAGAATGTCGTGAAGGCACATACAAACTAAAGACTTTTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13829
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033228 Nonsense 225 917 7 23
ENSDART00000038499 Nonsense 223 1434 7 34
Genomic Location (Zv9):
Chromosome 15 (position 20131700)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 21234326
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTTATTTTACTACTAATGACTTTRATTTCTGTCYTCKGATTTCTAGTTT[T/A]GCCTAAGTTTGAAGTTACAGTAAAAAAACCAAATAAAGTGAGTGTTGATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11423
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033228   None 917 None 23
ENSDART00000038499 Nonsense 1398 1434 33 34
Genomic Location (Zv9):
Chromosome 15 (position 20159490)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 21262116
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTTGTGTTCTCCTGCAGATCTATAAAAATGTTGCAATGAATTACCAGATA[C/T]AAATGAAACAGGTTCTACCAGTTAAGAATCTCAAGCCAGCTGTGGTCAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link