taf9

Ensembl ID:
ENSDARG00000077870
ZFIN ID:
ZDB-GENE-030131-204
Description:
TAF9 RNA polymerase II, TATA box binding protein-associated factor [Source:RefSeq peptide;Acc:NP_00
Human Orthologues:
TAF9, TAF9B
Human Descriptions:
TAF9 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 32kDa [Source:HGNC Symbol;
TAF9B RNA polymerase II, TATA box binding protein (TBP)-associated factor, 31kDa [Source:HGNC Symbol
Mouse Orthologues:
Taf9, Taf9b
Mouse Descriptions:
TAF9 RNA polymerase II, TATA box binding protein (TBP)-associated factor Gene [Source:MGI Symbol;Acc
TAF9B RNA polymerase II, TATA box binding protein (TBP)-associated factor Gene [Source:MGI Symbol;Ac

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa5685 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa5685
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111885 Nonsense 179 248 6 7
Genomic Location:
Chromosome 21 (position 37686417)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGCAGACAGTGGGGACAAAAGTGGGAACACCAGTGTCACTGACTGGCCAG[C/T]GATTCACCGTTCAGATTCCCTCATCGCAGACTGCCTCGGTCAAGTCAGGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/3l0dvtee