si:ch211-8c17.9

Ensembl ID:
ENSDARG00000077868
ZFIN ID:
ZDB-GENE-091204-214
Human Orthologue:
BTBD17
Human Description:
BTB (POZ) domain containing 17 [Source:HGNC Symbol;Acc:33758]
Mouse Orthologue:
Btbd17
Mouse Description:
BTB (POZ) domain containing 17 Gene [Source:MGI Symbol;Acc:MGI:1919264]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa19952 Nonsense Available for shipment Available now
sa9971 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa19952
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112022 Nonsense 266 515 3 3
ENSDART00000142553 Nonsense 229 477 3 3
Genomic Location (Zv9):
Chromosome 3 (position 12382229)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 12733420
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGAACTGCTGCTGTCTTTGCTGCAGCGCTCAGATCTGGTTCTGCAAAGC[G/T]AACTGGAGCTGTATGAAGCCCTGGAAGCATGGATCAACCAAAACCAGCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9971
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112022 Nonsense 412 515 3 3
ENSDART00000142553 Nonsense 375 477 3 3
Genomic Location (Zv9):
Chromosome 3 (position 12382669)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 12732980
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AACGCTCTTTTCTCTCCACGTTGGCTTCCTCTCAGCGTGCGATCCTCTTA[T/A]CCAGAGCAGGGATCCATGCTGCYGACTCGTACTGATGCAGGCCGTCCTCG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link