nostrin

Ensembl ID:
ENSDARG00000077866
ZFIN ID:
ZDB-GENE-070522-2
Description:
nostrin [Source:RefSeq peptide;Acc:NP_001107076]
Human Orthologue:
NOSTRIN
Human Description:
nitric oxide synthase trafficker [Source:HGNC Symbol;Acc:20203]
Mouse Orthologue:
Nostrin
Mouse Description:
nitric oxide synthase trafficker Gene [Source:MGI Symbol;Acc:MGI:3606242]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15123 Essential Splice Site Available for shipment Available now
sa15830 Essential Splice Site Available for shipment Available now
sa9638 Essential Splice Site Available for shipment Available now
sa25441 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa15123
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113855 Essential Splice Site 87 537 4 16
ENSDART00000142338   None 65 None 2
ENSDART00000143102 Essential Splice Site 87 404 4 14
Genomic Location (Zv9):
Chromosome 9 (position 49905351)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 49160547
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CYTGGTCCTTCATATCAGATGAGATGTTCRCCTCGGCAGATGCCCACCGG[T/C]ACCACACTACACTGCATCATTCTCCTCRCTTCATTATTCATGTGGCTGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15830
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113855 Essential Splice Site 87 537 5 16
ENSDART00000142338   None 65 None 2
ENSDART00000143102 Essential Splice Site 87 404 5 14
Genomic Location (Zv9):
Chromosome 9 (position 49905273)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 49160469
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
RCTTCATTATTCATGTGGCTGCTGTGCATTTWTATCTGCATTATTCTTAC[A/C]GCATTCTGGGAAACGCTCTCAATCAGGAYGTCATTCAGGAAATCCGGCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9638
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113855 Essential Splice Site 210 537 8 16
ENSDART00000142338   None 65 None 2
ENSDART00000143102 Essential Splice Site 210 404 8 14
Genomic Location (Zv9):
Chromosome 9 (position 49897168)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 49152364
KASP Assay ID:
554-6636.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTCACCACATCCGCCTGAAGCTGGAGAACACGSTCAAAACATGCTACCAG[G/A]TTCAGATTGTTANNNTTTGAYACTTTYAGGAAGWTATTGAGTTTTGAYTKATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25441
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113855 Nonsense 323 537 12 16
ENSDART00000142338   None 65 None 2
ENSDART00000143102 Nonsense 323 404 12 14
Genomic Location (Zv9):
Chromosome 9 (position 49890425)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 49145621
KASP Assay ID:
554-7727.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAATGTACGCCTTTAGCTCAGCACTGACACATAAATCTGGTTTTCAGGTT[T/A]AGAGAAGATGGTGAAAGTCTATACAGAGCAACCAAACTTCTCAAACCAGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link