rasgrp3

Ensembl ID:
ENSDARG00000077864
ZFIN ID:
ZDB-GENE-070424-82
Description:
ras guanyl-releasing protein 3 [Source:RefSeq peptide;Acc:NP_001103934]
Human Orthologue:
RASGRP3
Human Description:
RAS guanyl releasing protein 3 (calcium and DAG-regulated) [Source:HGNC Symbol;Acc:14545]
Mouse Orthologue:
Rasgrp3
Mouse Description:
RAS, guanyl releasing protein 3 Gene [Source:MGI Symbol;Acc:MGI:3028579]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa28849 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa28849
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114212 Essential Splice Site 270 708 9 17
ENSDART00000129122 Essential Splice Site 270 708 8 16
ENSDART00000138069   None 87 None 5
Genomic Location (Zv9):
Chromosome 17 (position 23014902)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 23165051
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGAGAGAGGTGAATAATTTGAGTAGCTGTCATTTTCTCTTGCTATTGAC[A/T]GATCTGGAATGAAATGACAGAGCTGGTTTCGTCCAACGGTAATTACTGTG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link