ankhd1

Ensembl ID:
ENSDARG00000077860
ZFIN ID:
ZDB-GENE-090421-1
Human Orthologues:
ANKHD1, ANKHD1-EIF4EBP3, ANKRD17
Human Descriptions:
ANKHD1-EIF4EBP3 readthrough [Source:HGNC Symbol;Acc:33530]
ankyrin repeat and KH domain containing 1 [Source:HGNC Symbol;Acc:24714]
ankyrin repeat domain 17 [Source:HGNC Symbol;Acc:23575]
Mouse Orthologues:
Ankhd1, Ankrd17
Mouse Descriptions:
ankyrin repeat and KH domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:1921733]
ankyrin repeat domain 17 Gene [Source:MGI Symbol;Acc:MGI:1932101]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa10239 Nonsense Available for shipment Available now
sa37325 Essential Splice Site Mutation detected in F1 DNA During 2016
sa23949 Essential Splice Site Mutation detected in F1 DNA During 2016
sa37324 Nonsense Mutation detected in F1 DNA During 2016
sa23948 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa10239
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112410 Nonsense 883 2602 15 34
ENSDART00000147947 Nonsense 888 2607 15 34
Genomic Location (Zv9):
Chromosome 21 (position 25819392)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 26389210
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGGCGGCAGGGGTGGAGATGCCCGGCACCCCCCTGCCCTTGCAGGCCACA[C/T]AGCTGGGCTCTGACAACGAGTGTGAGGGGATTCACGAAAAGGAGGACCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37325
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112410 Essential Splice Site 1200 2602 19 34
ENSDART00000147947 Essential Splice Site 1205 2607 19 34
Genomic Location (Zv9):
Chromosome 21 (position 25813700)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 26383518
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCAACATCATCAAAATCCTTCTGAATGCTGGTGCTGAGATCAACTCTAGG[T/C]CAGAACATCTGTGCCCATTGGTTTAATCAGTTGTCTTAAGATTCATATTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23949
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112410 Essential Splice Site 1455 2602 24 34
ENSDART00000147947 Essential Splice Site 1460 2607 24 34
Genomic Location (Zv9):
Chromosome 21 (position 25812356)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 26382174
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGCAAACAAGAACGCCAGCATTCTGCTCAAGGAGCTTGATCTGGAAAAG[G/A]TTTGTCTCTTCTGATAACCAGTTAGATTAGCTAACTATCTTGTTGAGGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37324
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112410 Nonsense 2188 2602 29 34
ENSDART00000147947 Nonsense 2193 2607 29 34
Genomic Location (Zv9):
Chromosome 21 (position 25809006)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 26378824
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACCACCAACACCCTACTACCCCATGGCTCCAGGGGCCCTGCAGGAGCAG[C/T]AGTCTGTGTTTGTGCCTCCAGGAGCCACACAGGAGACCCTTAAACAACAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23948
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112410 Nonsense 2390 2602 31 34
ENSDART00000147947 Nonsense 2395 2607 31 34
Genomic Location (Zv9):
Chromosome 21 (position 25804779)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 26374597
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGATGCTCTTTTCATTCCTCATCGATTATAGGCGAGTCTCCAGTGCCCT[C/A]GGTGTCCTCTGGGGCATCGTCACCTCTTTGCACATCTACGGTGACTCCTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link