NP_001122273.1

Ensembl ID:
ENSDARG00000077858
Description:
hypothetical protein LOC798574 [Source:RefSeq peptide;Acc:NP_001122273]
Human Orthologue:
ASIP
Human Description:
agouti signaling protein [Source:HGNC Symbol;Acc:745]
Mouse Orthologue:
a
Mouse Description:
nonagouti Gene [Source:MGI Symbol;Acc:MGI:87853]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa13992 Essential Splice Site Available for shipment Available now
sa18595 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa13992
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113083 Essential Splice Site None 125 1 4
Genomic Location (Zv9):
Chromosome 6 (position 49934932)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 49984613
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCCAGCTTCACARAGGGAAAACTGGGGGCCTCAGTACTCACAAGGACAG[G/A]TCAGTTTGTAAATTCCCAACAGCGACTACTGAAGATTACCATGGGTAGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18595
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113083 Nonsense 94 125 4 4
Genomic Location (Zv9):
Chromosome 6 (position 49927947)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 49977628
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGAAGAGACCCCCGCCTCCGCCGAACTGTGTGCCCCTGTGGGCGAGCTGC[A/T]AGAGCCCGAACGCGGTGTGCTGCGAKCAGTGCGCTTTCTGCCACTGCCGC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Breast cancer: A meta-analysis of genome-wide association studies of breast cancer identifies two novel susceptibility loci at 6q14 and 20q11. (View Study)
  • Hair color: Web-based, participant-driven studies yield novel genetic associations for common traits. (View Study)
  • Melanoma: Genome-wide association study identifies three new melanoma susceptibility loci. (View Study)
  • Skin sensitivity to sun: Two newly identified genetic determinants of pigmentation in Europeans. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link