si:ch211-220i15.2

Ensembl ID:
ENSDARG00000077853
ZFIN IDs:
ZDB-GENE-041014-204, ZDB-GENE-041014-204, ZDB-GENE-041014-297
Description:
hypothetical protein LOC799958 [Source:RefSeq peptide;Acc:NP_001104700]
Human Orthologue:
TTLL2
Human Description:
tubulin tyrosine ligase-like family, member 2 [Source:HGNC Symbol;Acc:21211]
Mouse Orthologue:
Ttll2
Mouse Description:
tubulin tyrosine ligase-like family, member 2 Gene [Source:MGI Symbol;Acc:MGI:3644030]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa23793 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa23793
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113064 Nonsense 82 577 1 1
ENSDART00000132208 Nonsense 82 577 2 2
Genomic Location (Zv9):
Chromosome 20 (position 42781724)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 42852883
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGAGACTGAACCACCACCCCAAAGTGACCCACGTCACACGGAAGGACTA[T/A]CTGGTGCGCCACTTGCGGAGAATGAAGTGCGCTTTCGGCGCAACCCTGTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link