meis2.1

Ensembl ID:
ENSDARG00000077840
ZFIN IDs:
ZDB-GENE-000210-23, ZDB-GENE-020122-2, ZDB-GENE-020122-2
Description:
myeloid ecotropic viral integration site 2.1 [Source:RefSeq peptide;Acc:NP_570985]
Human Orthologue:
MEIS2
Human Description:
Meis homeobox 2 [Source:HGNC Symbol;Acc:7001]
Mouse Orthologue:
Meis2
Mouse Description:
Meis homeobox 2 Gene [Source:MGI Symbol;Acc:MGI:108564]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa4882 Essential Splice Site Mutation detected in F1 DNA During 2014
sa23645 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa4882
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033976 Essential Splice Site 148 393 None 13
ENSDART00000144970 Essential Splice Site 148 393 None 14

The following transcripts of ENSDARG00000077840 do not overlap with this mutation:

Genomic Location:
Chromosome 20 (position 10303834)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCGTGCAGAGAAGCCGTTATTTTCCTCTAACCCAGAGCTGGATAATTTGG[T/A]AAGTRTAAGATTTTATTTGGCGCTGTTTTGTTTCAGGTAAATTCGCTTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23645
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033976 Essential Splice Site 345 393 11 13
ENSDART00000144970 Essential Splice Site 345 393 12 14

The following transcripts of ENSDARG00000077840 do not overlap with this mutation:

Genomic Location:
Chromosome 20 (position 10289724)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAGTATCAGTGCGAGCGTATATCACATTTATATTGTGTTTTTGTGTGTTT[A/G]GTAAGTCAAGGAACCGCTTACAGCCCTGATGGTCAGCCTATGGGCGGCTT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/4fn2ot4m