meis2.1

Ensembl ID:
ENSDARG00000077840
ZFIN IDs:
ZDB-GENE-000210-23, ZDB-GENE-020122-2, ZDB-GENE-020122-2
Description:
myeloid ecotropic viral integration site 2.1 [Source:RefSeq peptide;Acc:NP_570985]
Human Orthologue:
MEIS2
Human Description:
Meis homeobox 2 [Source:HGNC Symbol;Acc:7001]
Mouse Orthologue:
Meis2
Mouse Description:
Meis homeobox 2 Gene [Source:MGI Symbol;Acc:MGI:108564]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa23645 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa23645
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033976 Essential Splice Site 345 393 11 13
ENSDART00000144970 Essential Splice Site 345 393 12 14

The following transcripts of ENSDARG00000077840 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 20 (position 10289724)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 10115398
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAGTATCAGTGCGAGCGTATATCACATTTATATTGTGTTTTTGTGTGTTT[A/G]GTAAGTCAAGGAACCGCTTACAGCCCTGATGGTCAGCCTATGGGCGGCTT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link