LOC100332921

Ensembl ID:
ENSDARG00000077839
Human Orthologue:
DHX30
Human Description:
DEAH (Asp-Glu-Ala-His) box polypeptide 30 [Source:HGNC Symbol;Acc:16716]
Mouse Orthologue:
Dhx30
Mouse Description:
DEAH (Asp-Glu-Ala-His) box polypeptide 30 Gene [Source:MGI Symbol;Acc:MGI:1920081]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa18715 Essential Splice Site Mutation detected in F1 DNA During 2014
sa10400 Essential Splice Site Available for shipment Available now
sa19646 Nonsense Mutation detected in F1 DNA During 2014
sa10286 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa18715
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113021 Essential Splice Site 133 1173 3 21
ENSDART00000113021 Essential Splice Site 133 1173 3 21
Genomic Location:
Chromosome 2 (position 257619)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACAGGAGGCGGAGCGAAACGCAGCAGCCGCAGCTCTACAGAAACTTTGCG[T/A]GAGATTTTACTCTCATTACACATCACATTAAACAGTACTACACTATTATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10400
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113021 Essential Splice Site 133 1173 3 21
ENSDART00000113021 Essential Splice Site 133 1173 3 21
Genomic Location:
Chromosome 2 (position 257619)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACAGGAGGCGGAGCGAAACGCAGCAGCCGCAGCTCTACAGAAACTTTGCG[T/A]GAGATTTTACTCTCATTACACATCACATTAAAYAGTACTACASTATTATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19646
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113021 Nonsense 306 1173 7 21
Genomic Location:
Chromosome 2 (position 263512)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGATCAGGTTCGAGAGGCCGGAGAGAGACACCGACAGCCCTGCCGGATG[C/T]AGATCCCAGAGCAGCTGGAGCTCAGGATACAGCAGTACCTCTCACAGGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10286
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113021 Nonsense 752 1173 14 21
Genomic Location:
Chromosome 2 (position 270171)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGCTGAATACYGTCTGGATTTCACAAGCAAACGTGACTCAGAGAAGAGGA[C/T]GAGCCGGACGCTGTCAGCCTGGACATTCTTATCATCTTTTCCCCAGAAAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/0nmybfjr