ENSDARG00000077826

Ensembl ID:
ENSDARG00000077826
Mouse Orthologue:
Ccdc48
Mouse Description:
coiled-coil domain containing 48 Gene [Source:MGI Symbol;Acc:MGI:3611451]

Alleles

There are 7 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa10299 Nonsense Available for shipment Available now
sa7670 Essential Splice Site Mutation detected in F1 DNA During 2014
sa21925 Nonsense Mutation detected in F1 DNA During 2014
sa11841 Nonsense Available for shipment Available now
sa9045 Nonsense Mutation detected in F1 DNA During 2014
sa13701 Nonsense Available for shipment Available now
sa21924 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa10299
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111539 Nonsense 24 586 1 12
Genomic Location:
Chromosome 11 (position 27599982)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TACAGCCGACCCGCGCGCAGGACACAATGGAYAGTRAGCACCCTGGCGTA[T/A]CATTACGGACTAGACCGTGGAGTGGAAAACGAAATTATAGTCCTCGCAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7670
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111539 Essential Splice Site 360 586 6 12
Genomic Location:
Chromosome 11 (position 27576097)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCCTGGGTCRAGGTCYTTTGCTGATCATTCCCCACGCTTTCCTGTTYAT[A/C]AAYTCCATTTTCATGTCCAATAAAAAGCATAGGTGAGTGGGTTTGACAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21925
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111539 Nonsense 418 586 9 12
Genomic Location:
Chromosome 11 (position 27562476)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTCTTGATGTTTTTTGTGTGCTCTCAGGTGTGATGAGAAGGCAGTGAAG[A/T]AGCTGTTGTCTCATTTTGGAGATTCTCGCACAGAGGAGAGCCAGACGGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11841
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111539 Nonsense 465 586 9 12
ENSDART00000111539 Nonsense 465 586 9 12
Genomic Location:
Chromosome 11 (position 27562335)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AACTGGAGCTGAAGGAGAGTCAGGCCARGAGGGCAGAGATGGACACWGAC[C/T]AKGTATGACTGCACYGCATTCAATSATATACAAAGTGCTCWTAAAWGAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9045
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111539 Nonsense 465 586 9 12
ENSDART00000111539 Nonsense 465 586 9 12
Genomic Location:
Chromosome 11 (position 27562335)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AACTGGAGCTGAAGGAGAGTCAGGCCARGAGGGCAGAGATGGACACWGAC[C/T]AGGTATGACTGCACYGCATTCAATSATATACAAAGTGCTCWTAAAWGAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13701
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111539 Nonsense 465 586 9 12
ENSDART00000111539 Nonsense 465 586 9 12
Genomic Location:
Chromosome 11 (position 27562335)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AACTGGAGCTGAAGGAGAGTCAGGCMARGAGGGCAGAGATGGACACWGAC[C/T]AKGTATGACTGCACYGCATTCAATSATATACAAAGTGCTCWTAAAWGAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21924
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111539 Essential Splice Site 542 586 12 12
Genomic Location:
Chromosome 11 (position 27553226)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATATAGATTAAATTAACCTCACAAACATCTAAACTACGTCTTCTCTGCA[G/A]GGAAAGCGCATATTTTAGAGGTGCTGAACGCTCTCTGTCATGAACTGGCC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/sy75w8gy