HMGXB3

Ensembl ID:
ENSDARG00000077823
Description:
HMG box domain containing 3 [Source:HGNC Symbol;Acc:28982]
Human Orthologue:
HMGXB3
Human Description:
HMG box domain containing 3 [Source:HGNC Symbol;Acc:28982]
Mouse Orthologue:
Hmgxb3
Mouse Description:
HMG box domain containing 3 Gene [Source:MGI Symbol;Acc:MGI:2441817]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa3895 Nonsense Mutation detected in F1 DNA During 2014
sa9952 Nonsense Available for shipment Available now
sa10782 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa3895
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110721 Nonsense 436 1222 7 20
Genomic Location:
Chromosome 14 (position 3081923)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGAGCATTGGGTGGTGGTCAGATTCAGATTATCGCTAGAGAAAAAGCCTG[C/A]AGTGCTGTGCAGAAACGACGCATACGAGCTATTCTTCCAGCGCCATCACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9952
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110721 Nonsense 1038 1222 19 20
Genomic Location:
Chromosome 14 (position 3065760)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TATGTGGCAGACTGTGCCCAGAAGGTGGCGCTCTGTGCTGAYGTGTCCTA[T/A]CCTCAACTCGCCAAACAGATGTGGGGGGAAAACCAGGGCTGTTTCTCTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10782
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110721 Nonsense 1062 1222 20 20
Genomic Location:
Chromosome 14 (position 3063881)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
RCACAACCATCTCAACAATAATWWTGCACATCTCCTGTTGTGTTTCAGTA[T/G]GTCTCSTGCTCRGAGCTCCAGGATCAGCCATACAGTCTGGACCTCACCGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/xs6v1jll