nrg2a

Ensembl ID:
ENSDARG00000077818
ZFIN ID:
ZDB-GENE-070615-10
Description:
neuregulin 2a [Source:RefSeq peptide;Acc:NP_001092724]
Human Orthologue:
NRG2
Human Description:
neuregulin 2 [Source:HGNC Symbol;Acc:7998]
Mouse Orthologue:
Nrg2
Mouse Description:
neuregulin 2 Gene [Source:MGI Symbol;Acc:MGI:1098246]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa23960 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa23960
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098696 Nonsense 230 488 8 9
ENSDART00000124826 Nonsense 234 492 8 9
ENSDART00000125652 Nonsense 236 494 9 10
ENSDART00000128237 Nonsense 232 565 9 11
Genomic Location (Zv9):
Chromosome 21 (position 27959359)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 28528270
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATAGCCCATTCAAGTAAAGCATGACCTATTTTTATACCTGATTGCAGTA[T/A]ATCTCCAAAAATGTGCCAGCAACCGAGAGAGTAATTCGGCACGGAGCAGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link