si:ch211-125e6.9

Ensembl ID:
ENSDARG00000077812
ZFIN ID:
ZDB-GENE-070912-43
Human Orthologue:
SLC5A3
Human Description:
solute carrier family 5 (sodium/myo-inositol cotransporter), member 3 [Source:HGNC Symbol;Acc:11038]
Mouse Orthologue:
Slc5a3
Mouse Description:
solute carrier family 5 (inositol transporters), member 3 Gene [Source:MGI Symbol;Acc:MGI:1858226]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa1877 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa1877
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115265 Nonsense 245 709 1 1
ENSDART00000131742 Nonsense 238 702 1 1
Genomic Location (Zv9):
Chromosome 9 (position 34169587)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 33325533
KASP Assay ID:
554-1867.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGCCATCCTGGCTARCAGCAACTTTAGCTTTGAGTACACAAACTCCTGT[C/T]GAATCTATCCCAAGCCAGATTCCCTTAAGCTCCTACGAGGACCACTTGAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link