LOC571586

Ensembl ID:
ENSDARG00000077805
Human Orthologue:
JMJD1C
Human Description:
jumonji domain containing 1C [Source:HGNC Symbol;Acc:12313]
Mouse Orthologue:
Jmjd1c
Mouse Description:
jumonji domain containing 1C Gene [Source:MGI Symbol;Acc:MGI:1918614]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa23163 Essential Splice Site Mutation detected in F1 DNA During 2014
sa11990 Essential Splice Site Available for shipment Available now
sa10357 Nonsense Available for shipment Available now
sa14737 Essential Splice Site Available for shipment Available now
sa17049 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa23163
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114523 Essential Splice Site 106 2603 3 27
Genomic Location:
Chromosome 17 (position 43805191)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTTGTCTTGTATCGAGATGGACTGATTGGTTGTGATATTTTGTTTGACA[G/T]AAATTCCGGCCTCTGATTGGTCAGTCATGCGTGGGAGGCCTGTCTGTGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11990
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114523 Essential Splice Site 313 2603 8 27
Genomic Location:
Chromosome 17 (position 43767143)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGATGAAAAAGAAGGAATGAGGGAGGAAAAGAGGAGTGATGAGRGAARAG[G/A]TGAGTTGGAGCTGTAGATAATGATTATGAGGATGTTAAAAGCACTATCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10357
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114523 Nonsense 1463 2603 11 27
Genomic Location:
Chromosome 17 (position 43761434)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACTTCCCTCATTTGAAAAAACACAGAGCTGGACTAACTGCTGCTATCTCT[A/T]GAGCTAACACACATACAATTCAGCCTCAACACACTACATATCCTTTGMAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14737
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114523 Essential Splice Site 2089 2603 17 27
Genomic Location:
Chromosome 17 (position 43756086)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCAGAAGAACTCACAGCACGTCACACTGAGAGCGCACACTGAGAGAAGAG[G/A]TAATGACAGWAGTAATGCGCAATAATACGCTAAGATATTTTTCACAACAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17049
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114523 Essential Splice Site 2295 2603 20 27
Genomic Location:
Chromosome 17 (position 43752979)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CACCAACTCCAAAGTCAAGGAGTTCTGGGAYGGTTTTGAAGATGCCTCAA[G/A]TGAGTGATCCAGTTTAGCAATTCTGCGCTCATCATTTKTAATTTGCTGCA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/zlxazh40