A4IGG8_DANRE

Ensembl ID:
ENSDARG00000077804
Description:
Putative uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:A4IGG8]
Human Orthologue:
HGSNAT
Human Description:
heparan-alpha-glucosaminide N-acetyltransferase [Source:HGNC Symbol;Acc:26527]
Mouse Orthologue:
Hgsnat
Mouse Description:
heparan-alpha-glucosaminide N-acetyltransferase Gene [Source:MGI Symbol;Acc:MGI:1196297]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17427 Essential Splice Site Available for shipment Available now
sa19454 Essential Splice Site Available for shipment Available now
sa32629 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa17427
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109911 Essential Splice Site 223 643 6 18
Genomic Location:
Chromosome 1 (position 13959575)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACTTATTCGCTTGGGGGGAACAGTTGAGACAGAGAGGCTGATAAACTCGG[T/C]AAAAATGGCTTTAATACATTTATAATRCTACCCCTAATACTGTGTGCTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19454
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109911 Essential Splice Site 425 643 12 18
Genomic Location:
Chromosome 1 (position 13969159)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGGTCTGGCTGTGTTTGACCTTCCTCCTCCCAGTGCCTGGCTGCCCAACG[T/C]TAGTACAGTCTTATTCATGATATGAATGCATCATATTTTCAGAGCTGTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32629
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109911 Nonsense 534 643 16 18
Genomic Location:
Chromosome 1 (position 13976049)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAACTGTTTACATTAAGGGGATCATCTCAGCTGTATTGACCAAGTGCTCC[A/T]GAAATGATGGCTTCATCCCTGTCAATAAAAACCTGTGGTAAACAAAGTCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link