A4IGG8_DANRE

Ensembl ID:
ENSDARG00000077804
Description:
Putative uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:A4IGG8]
Human Orthologue:
HGSNAT
Human Description:
heparan-alpha-glucosaminide N-acetyltransferase [Source:HGNC Symbol;Acc:26527]
Mouse Orthologue:
Hgsnat
Mouse Description:
heparan-alpha-glucosaminide N-acetyltransferase Gene [Source:MGI Symbol;Acc:MGI:1196297]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17427 Essential Splice Site Available for shipment Available now
sa19454 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa17427
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109911 Essential Splice Site 223 643 6 18
Genomic Location:
Chromosome 1 (position 13959575)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACTTATTCGCTTGGGGGGAACAGTTGAGACAGAGAGGCTGATAAACTCGG[T/C]AAAAATGGCTTTAATACATTTATAATRCTACCCCTAATACTGTGTGCTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19454
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109911 Essential Splice Site 425 643 12 18
Genomic Location:
Chromosome 1 (position 13969159)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGGTCTGGCTGTGTTTGACCTTCCTCCTCCCAGTGCCTGGCTGCCCAACG[T/C]TAGTACAGTCTTATTCATGATATGAATGCATCATATTTTCAGAGCTGTCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/7hib35rg