fancm

Ensembl ID:
ENSDARG00000077800
ZFIN ID:
ZDB-GENE-090929-1
Description:
Fanconi anemia, complementation group M [Source:RefSeq peptide;Acc:NP_001107132]
Human Orthologue:
FANCM
Human Description:
Fanconi anemia, complementation group M [Source:HGNC Symbol;Acc:23168]
Mouse Orthologue:
Fancm
Mouse Description:
Fanconi anemia, complementation group M Gene [Source:MGI Symbol;Acc:MGI:2442306]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa24767 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa24767
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052772 Nonsense 274 693 7 15
Genomic Location:
Chromosome Zv9_NA92 (position 5934)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGAAGATGGAGATGTTTCCTCAGATGAAGATGATGGAGACGAGCAGAAC[C/T]AATCACTGCAGGGCTTCGTGGTCAACAACACACAGTGCTCGCAGGGGCTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/57wdlthh