BRSK2 (1 of 2)

Ensembl ID:
ENSDARG00000077791
Description:
BR serine/threonine kinase 2 [Source:HGNC Symbol;Acc:11405]
Human Orthologue:
BRSK2
Human Description:
BR serine/threonine kinase 2 [Source:HGNC Symbol;Acc:11405]
Mouse Orthologue:
Brsk2
Mouse Description:
BR serine/threonine kinase 2 Gene [Source:MGI Symbol;Acc:MGI:1923020]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa9674 Essential Splice Site Available for shipment Available now
sa3633 Nonsense Mutation detected in F1 DNA During 2014
sa6150 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa9674
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109147 Essential Splice Site 117 675 4 19
Genomic Location:
Chromosome 7 (position 50833263)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTCAAGCTTKGGTGAGACAMATGATGARATATTGTCTTGTTTTCTTGCA[G/T]ATCCCCTCACTATGCCTGTCCAGAGGTTATAAGGGTAAGTATGTGCTCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3633
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109147 Nonsense 581 675 16 19
Genomic Location:
Chromosome 7 (position 50793302)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCAAACGGGTGGTGGAGACGATTCAGGCTCAGTTGTTAAGTACACATGAC[C/T]AGCCTGGTGTCCAGCAGCTGTCTGGTGAGTGGTCAATCTCTMCACTGACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6150
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109147 Essential Splice Site 605 675 18 19
Genomic Location:
Chromosome 7 (position 50784346)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AYCCAGTGAAGATCACAGATCAGATGGAGACACAGAGACTCACTGCCACA[G/C]CAAGACCTTRGAACAATAAAACAGCTGCACTGTCGAGCCTGCCGATGTGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/phuyw9ic