ARHGEF10

Ensembl ID:
ENSDARG00000077788
Description:
Rho guanine nucleotide exchange factor (GEF) 10 [Source:HGNC Symbol;Acc:14103]
Human Orthologue:
ARHGEF10
Human Description:
Rho guanine nucleotide exchange factor (GEF) 10 [Source:HGNC Symbol;Acc:14103]
Mouse Orthologue:
Arhgef10
Mouse Description:
Rho guanine nucleotide exchange factor (GEF) 10 Gene [Source:MGI Symbol;Acc:MGI:2444453]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa23085 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa23085
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110451 Nonsense 188 1239 3 26
Genomic Location:
Chromosome 17 (position 25055228)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCCATCAGAGCAGAGCGGTCCGCCCTCCTCTCCCTCAGCCAATCAGATT[G/T]AAGGAGTTGTTCAGGATGTGTTAGGTAGCCCAGGGTTGTCCTCTGGGTAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/v5gxyiyr