
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
ARHGEF10
- Ensembl ID:
- ENSDARG00000077788
- Description:
- Rho guanine nucleotide exchange factor (GEF) 10 [Source:HGNC Symbol;Acc:14103]
- Human Orthologue:
- ARHGEF10
- Human Description:
- Rho guanine nucleotide exchange factor (GEF) 10 [Source:HGNC Symbol;Acc:14103]
- Mouse Orthologue:
- Arhgef10
- Mouse Description:
- Rho guanine nucleotide exchange factor (GEF) 10 Gene [Source:MGI Symbol;Acc:MGI:2444453]
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa23085 | Nonsense | Available for shipment | Available now |
sa28858 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa23085
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- G > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000110451 | Nonsense | 188 | 1239 | 3 | 26 |
- Genomic Location (Zv9):
- Chromosome 17 (position 25055228)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 17 25208670 GRCz11 17 25227071 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TGCCATCAGAGCAGAGCGGTCCGCCCTCCTCTCCCTCAGCCAATCAGATT[G/T]AAGGAGTTGTTCAGGATGTGTTAGGTAGCCCAGGGTTGTCCTCTGGGTAT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa28858
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000110451 | Essential Splice Site | 883 | 1239 | 19 | 26 |
- Genomic Location (Zv9):
- Chromosome 17 (position 25077411)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 17 25230853 GRCz11 17 25249254 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CAGCTGATCGCTGTAGGATACAACTACAGTTACCAGGGAAACAAGACAAG[T/A]ATGTGTGACCTACACTTTACACTAAAGAAAGCCCACACTAAAAAGTTTGG
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Multiple sclerosis: A genome-wide association study of brain lesion distribution in multiple sclerosis. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: