ARHGEF10

Ensembl ID:: ENSDARG00000077788
Description:: Rho guanine nucleotide exchange factor (GEF) 10 [Source:HGNC Symbol;Acc:14103]
Human Orthologue:: ARHGEF10
Human Description:: Rho guanine nucleotide exchange factor (GEF) 10 [Source:HGNC Symbol;Acc:14103]
Mouse Orthologue:: Arhgef10
Mouse Description:: Rho guanine nucleotide exchange factor (GEF) 10 Gene [Source:MGI Symbol;Acc:MGI:2444453]

Alleles

There are 2 alleles of this gene:

Allele name	Consequence	Status	Availability Estimate
sa23085	Nonsense	Mutation detected in F1 DNA	During 2015
sa28858	Essential Splice Site	Mutation detected in F1 DNA	During 2015

Mutation Details

Allele Name:: sa23085
Current Status:: Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:: We currently estimate that this allele will be available during 2015.
Mutation:: G > T
Consequence:: Nonsense

Transcript ID	Consequence	Amino Acid Affected	Amino Acid Total	Exon Affected	Exon Total
ENSDART00000110451	Nonsense	188	1239	3	26

Genomic Location:: Chromosome 17 (position 25055228)
KASP Assay ID:: None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:: None
Flanking Sequence:: TGCCATCAGAGCAGAGCGGTCCGCCCTCCTCTCCCTCAGCCAATCAGATT[G/T]AAGGAGTTGTTCAGGATGTGTTAGGTAGCCCAGGGTTGTCCTCTGGGTAT
Associated Phenotype:: Not determined

Mutation Details

Allele Name:: sa28858
Current Status:: Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:: We currently estimate that this allele will be available during 2015.
Mutation:: T > A
Consequence:: Essential Splice Site

Transcript ID	Consequence	Amino Acid Affected	Amino Acid Total	Exon Affected	Exon Total
ENSDART00000110451	Essential Splice Site	883	1239	19	26

Genomic Location:: Chromosome 17 (position 25077411)
KASP Assay ID:: None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:: None
Flanking Sequence:: CAGCTGATCGCTGTAGGATACAACTACAGTTACCAGGGAAACAAGACAAG[T/A]ATGTGTGACCTACACTTTACACTAAAGAAAGCCCACACTAAAAAGTTTGG
Associated Phenotype:: Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

Multiple sclerosis: A genome-wide association study of brain lesion distribution in multiple sclerosis. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

OMIM

Slowed nerve conduction velocity, AD

More OMIM information for ARHGEF10

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: