LOC100331179

Ensembl ID:
ENSDARG00000077782
Human Orthologue:
ACER2
Human Description:
alkaline ceramidase 2 [Source:HGNC Symbol;Acc:23675]
Mouse Orthologue:
Acer2
Mouse Description:
alkaline ceramidase 2 Gene [Source:MGI Symbol;Acc:MGI:1920932]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa1734 Nonsense Available for shipment Available now
sa7112 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa1734
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111797 Nonsense 29 277 1 6
Genomic Location:
Chromosome 7 (position 75219364)
KASP Assay ID:
554-1679.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGGCTGGCAGCTCCGAGGTGGACTGGTGTGAAGGGAATTACCTTATTTA[T/A]CCGGGAATTGCGGAATTTTATAACACGGTACGTCGCTCAGATGTTTCTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7112
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111797 Essential Splice Site 124 277 3 6
Genomic Location:
Chromosome 7 (position 75213230)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCATGTGGTTTCCCAAGAGATACCTGCCCAAGATATTCAGRAGAGAYAGG[T/C]ACGMTAGCAGATACAYACAGACATCYAATTATACTGCGGACAGAGGTGGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/20kwfy03