adamts9

Ensembl ID:
ENSDARG00000077778
ZFIN ID:
ZDB-GENE-070814-6
Human Orthologue:
ADAMTS9
Human Description:
ADAM metallopeptidase with thrombospondin type 1 motif, 9 [Source:HGNC Symbol;Acc:13202]
Mouse Orthologue:
Adamts9
Mouse Description:
a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 9 Gene [

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa9181 Nonsense Mutation detected in F1 DNA During 2014
sa9314 Nonsense Mutation detected in F1 DNA During 2014
sa17633 Nonsense Available for shipment Available now
sa4417 Nonsense Mutation detected in F1 DNA During 2014
sa18108 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa9181
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109440 Nonsense 28 1443 1 28
ENSDART00000138964 None None 1405 None 27
Genomic Location:
Chromosome 11 (position 19578560)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAGTATTACTCTCTGATCTAATGAATGCACTAGCTTCAACGGGGAGACTG[C/T]GAGGTTCAGAAAAAGGTACGTGCTCTTTTCACGATCGTTTANNCTCTCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9314
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109440 Nonsense 275 1443 4 28
ENSDART00000138964 Nonsense 241 1405 3 27
Genomic Location:
Chromosome 11 (position 19585383)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAAAGCAGTGACTCCAAGCCACACCGGAGATCAAAGCGTTTCCTCTCCTA[C/A]CCCCGTTTTGTTGAAGTCATGGTTGTGGCAGACAGCAAGATGGTGGAACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17633
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109440 Nonsense 356 1443 6 28
ENSDART00000138964 Nonsense 322 1405 5 27
Genomic Location:
Chromosome 11 (position 19588074)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTATCTCCTTCAAWGCACAAGCCACTTTGAAAAACTTCTGCATATGGCAG[C/T]AAAGTCAAAATCACCCTGATGACAACCATCCCTCACATCACGACACCGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa4417
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109440 Nonsense 455 1443 9 28
ENSDART00000138964 Nonsense 421 1405 8 27
Genomic Location:
Chromosome 11 (position 19595033)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGGATGGAGTCAAGAACCAGCAACATGTGATGGCYCCTACGCTCAATTA[T/G]TACACTAATCCCTGGATGTGGTCCAAATGCAGTCGGAAATACATCACAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18108
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109440 Nonsense 640 1443 13 28
ENSDART00000138964 Nonsense 606 1405 12 27
Genomic Location:
Chromosome 11 (position 19603775)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
YCTGTAACTCTGAGCCATGCTCCAAGCAAAAGAAAGACTTCAGGGAGRAA[C/T]AGTGTGCCAGCTTTGATGGACGGCACTTCAACATCAATGGTCTACCTCCA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/5hpo5p0f