adamts9

Ensembl ID:
ENSDARG00000077778
ZFIN ID:
ZDB-GENE-070814-6
Human Orthologue:
ADAMTS9
Human Description:
ADAM metallopeptidase with thrombospondin type 1 motif, 9 [Source:HGNC Symbol;Acc:13202]
Mouse Orthologue:
Adamts9
Mouse Description:
a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 9 Gene [

Alleles

There are 9 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa41811 Nonsense Mutation detected in F1 DNA During 2016
sa9181 Nonsense Mutation detected in F1 DNA During 2016
sa9314 Nonsense Mutation detected in F1 DNA During 2016
sa17633 Nonsense Available for shipment Available now
sa41812 Essential Splice Site Mutation detected in F1 DNA During 2016
sa30656 Nonsense Mutation detected in F1 DNA During 2016
sa35066 Nonsense Mutation detected in F1 DNA During 2016
sa18108 Nonsense Available for shipment Available now
sa41813 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa41811
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109440 Nonsense 3 1443 1 28
ENSDART00000138964   None 1405 None 27
Genomic Location (Zv9):
Chromosome 11 (position 19578486)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 18995800
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTCGGGCTTGCTTGCATTCATTTTTTCTAAACGTGGACAATCATGGTTT[T/A]GTTCTCCTGGGGAATTAGTTTTTTAGTATTACTCTCTGATCTAATGAATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9181
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109440 Nonsense 28 1443 1 28
ENSDART00000138964   None 1405 None 27
Genomic Location (Zv9):
Chromosome 11 (position 19578560)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 18995874
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAGTATTACTCTCTGATCTAATGAATGCACTAGCTTCAACGGGGAGACTG[C/T]GAGGTTCAGAAAAAGGTACGTGCTCTTTTCACGATCGTTTANNCTCTCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9314
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109440 Nonsense 275 1443 4 28
ENSDART00000138964 Nonsense 241 1405 3 27
Genomic Location (Zv9):
Chromosome 11 (position 19585383)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 19002697
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAAAGCAGTGACTCCAAGCCACACCGGAGATCAAAGCGTTTCCTCTCCTA[C/A]CCCCGTTTTGTTGAAGTCATGGTTGTGGCAGACAGCAAGATGGTGGAACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17633
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109440 Nonsense 356 1443 6 28
ENSDART00000138964 Nonsense 322 1405 5 27
Genomic Location (Zv9):
Chromosome 11 (position 19588074)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 19005388
KASP Assay ID:
2260-4159.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTATCTCCTTCAAWGCACAAGCCACTTTGAAAAACTTCTGCATATGGCAG[C/T]AAAGTCAAAATCACCCTGATGACAACCATCCCTCACATCACGACACCGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41812
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109440 Essential Splice Site 377 1443 6 28
ENSDART00000138964 Essential Splice Site 343 1405 5 27
Genomic Location (Zv9):
Chromosome 11 (position 19588139)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 19005453
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTGATGACAACCATCCCTCACATCACGACACCGCCATCTTAATCACAAG[G/A]TGAGAAATATTCATATGCTTTCTTACCCCTTTTTATTGCTCACTTGTGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30656
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109440 Nonsense 422 1443 8 28
ENSDART00000138964 Nonsense 388 1405 7 27
Genomic Location (Zv9):
Chromosome 11 (position 19591916)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 19009230
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCAGTATTAATGAGGATAATGGACTCAGTACTGCTTTCACCATCGCTCAT[G/T]AGCTCGGCCATGTGTGAGTACTGTTGGGTTTTTTGTGAAATACTGTGAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35066
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109440 Nonsense 588 1443 12 28
ENSDART00000138964 Nonsense 554 1405 11 27
Genomic Location (Zv9):
Chromosome 11 (position 19603348)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 19020662
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTTCCAGTTGAGGGTGCCTGGGGCGTTTGGAGTCCCTTTGGCACGTGCT[C/A]AAGGACCTGTGGAGGGGGAATCAAGATCGCTGTCCGCGAATGTAACCGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18108
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109440 Nonsense 640 1443 13 28
ENSDART00000138964 Nonsense 606 1405 12 27
Genomic Location (Zv9):
Chromosome 11 (position 19603775)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 19021089
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
YCTGTAACTCTGAGCCATGCTCCAAGCAAAAGAAAGACTTCAGGGAGRAA[C/T]AGTGTGCCAGCTTTGATGGACGGCACTTCAACATCAATGGTCTACCTCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41813
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109440 Nonsense 952 1443 20 28
ENSDART00000138964 Nonsense 918 1405 19 27
Genomic Location (Zv9):
Chromosome 11 (position 19613526)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 19030840
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGCGGCATGTGGTGTGGGCTACCGGTCTTTGGATATTTACTGCACCAAA[C/T]AGAGCAGATTGGATGGGAAAACCCAGAAGGTGGATGAGCGGTACTGCAGC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link