ck2b

Ensembl ID:
ENSDARG00000077776
ZFIN ID:
ZDB-GENE-990415-29
Description:
Casein kinase II subunit beta [Source:UniProtKB/Swiss-Prot;Acc:Q91398]
Human Orthologue:
CSNK2B
Human Description:
casein kinase 2, beta polypeptide [Source:HGNC Symbol;Acc:2460]
Mouse Orthologue:
Csnk2b
Mouse Description:
casein kinase 2, beta polypeptide Gene [Source:MGI Symbol;Acc:MGI:88548]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa23533 Essential Splice Site Available for shipment Available now
sa5924 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa23533
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109258 Essential Splice Site None 215 None 7

The following transcripts of ENSDARG00000077776 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 19 (position 27221967)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 27152079
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTTGTGTCGCTGCGGCTAACATCGACCCCGGGAGATCCTTGAGGTAACG[T/C]CAGTAAACGCTTTTATCGCTATTATGAGCAGGGATGTGAAGTAATTTCGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5924
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109258 Essential Splice Site 123 215 None 7

The following transcripts of ENSDARG00000077776 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 19 (position 27217296)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 27147408
KASP Assay ID:
554-3778.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCACATGAGCTCCACTGAAACTTGAAGGAATGAATCTTTTGCCCTCTCC[A/T]GGCCTCTCTGACATTCCCGGCGAGGCTATGGTGAAGCTCTACTGCCCCAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link