si:busm1-64d20.2

Ensembl ID:
ENSDARG00000077773
ZFIN ID:
ZDB-GENE-040724-240
Description:
Si:busm1-64d20.2 protein [Source:UniProtKB/TrEMBL;Acc:A8WGC5]
Human Orthologue:
ENPP7
Human Description:
ectonucleotide pyrophosphatase/phosphodiesterase 7 [Source:HGNC Symbol;Acc:23764]
Mouse Orthologue:
Enpp7
Mouse Description:
ectonucleotide pyrophosphatase/phosphodiesterase 7 Gene [Source:MGI Symbol;Acc:MGI:3027917]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa35335 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa35335
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075564 Essential Splice Site 469 488 5 6
Genomic Location (Zv9):
Chromosome 12 (position 34389842)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 32308808
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGGTTGTCACATCCTACAACGGATATAAAAAGCACAAACTGTATTCAAA[G/A]TAGGGCACAAAGCTACATTAACACATTATTTTTTGGGACAGTTTCTTCCC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link