cx44.2

Ensembl ID:
ENSDARG00000077765
ZFIN ID:
ZDB-GENE-010619-1
Description:
connexin 44.2 [Source:RefSeq peptide;Acc:NP_571885]
Human Orthologue:
GJC2
Human Description:
gap junction protein, gamma 2, 47kDa [Source:HGNC Symbol;Acc:17494]
Mouse Orthologue:
Gjc2
Mouse Description:
gap junction protein, gamma 2 Gene [Source:MGI Symbol;Acc:MGI:2153060]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa11983 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa11983
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044519 Nonsense 107 391 2 3
ENSDART00000114264 Nonsense 107 391 2 4
Genomic Location:
Chromosome 6 (position 22690383)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TATCTCGGCTTTGCCATGCACAAAATTGCTCGAATGGCCGATGATGAATA[T/A]CGACCACGCAAACGCAAAMTGCTGTCTATGGTTCATCGAGGWATGAGCCG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/3by7eaxj