NP_001103295.1

Ensembl ID:
ENSDARG00000077764
Description:
hypothetical protein LOC569067 [Source:RefSeq peptide;Acc:NP_001103295]
Human Orthologue:
FAAH
Human Description:
fatty acid amide hydrolase [Source:HGNC Symbol;Acc:3553]
Mouse Orthologue:
Faah
Mouse Description:
fatty acid amide hydrolase Gene [Source:MGI Symbol;Acc:MGI:109609]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa11054 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa11054
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109576 Essential Splice Site 461 590 12 15
Genomic Location (Zv9):
Chromosome 6 (position 3343788)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 3376188
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
YTTTTCAAGGTCTGTAGCTGAATTATGGAGGCAGCATGCAAATGTTGAGG[T/G]AATGCTTTATTATAAGAGTTTAAGCAACTTTMAGAGTTGCCCTAGACCAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link