KIAA0467

Ensembl ID:
ENSDARG00000077753
Description:
KIAA0467 [Source:HGNC Symbol;Acc:29040]
Human Orthologue:
KIAA0467
Human Description:
KIAA0467 [Source:HGNC Symbol;Acc:29040]
Mouse Orthologue:
Szt2
Mouse Description:
seizure threshold 2 Gene [Source:MGI Symbol;Acc:MGI:3033336]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa9696 Nonsense Available for shipment Available now
sa9524 Nonsense Available for shipment Available now
sa12238 Nonsense Available for shipment Available now
sa25326 Nonsense Mutation detected in F1 DNA During 2016
sa26654 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa9696
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114701 Nonsense 409 3183 8 75
ENSDART00000114701 Nonsense 409 3183 8 75
Genomic Location (Zv9):
Chromosome 6 (position 2272526)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 2345328
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTCCTTCTATCTGGTGCGTCTGATCTCTAAAACTCCCTGTATGGTGCTG[C/T]GATTGGGCTTCCCGATAGGGACTCTGGCTCACACCAGGAACAAGGTGAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9524
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114701 Nonsense 409 3183 8 75
ENSDART00000114701 Nonsense 409 3183 8 75
Genomic Location (Zv9):
Chromosome 6 (position 2272526)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 2345328
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTCCTTCTATCTGGTGCGTCTGATCTCTAAAACTCCCTGTATGGTGCTG[C/T]GATTGGGCTTCCCGATAGGGACTCTGGCTCACACCAGGAACAAGGTGAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12238
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114701 Nonsense 550 3183 10 75
Genomic Location (Zv9):
Chromosome 6 (position 2275542)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 2348344
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGCRTCGCTCTCTCGATACTTCCTGCAYCAGCGCTGGGTTTGGGCCTTA[C/T]AGAACGGATCGGGAACYACCGTAWCSCTTTACGCTGTTGCTCGTATCCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25326
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114701 Nonsense 868 3183 19 75
Genomic Location (Zv9):
Chromosome 6 (position 2283575)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 2356377
KASP Assay ID:
554-7728.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAATGTGGATCTTGCGGATGAAGAGCCAGCTGGAGCGGAGCCGGGCGGTT[T/A]ATCTCCTCGCTGGAAATGTTACGCCAAATACATCAGCCATCAGCAGATCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa26654
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114701 Essential Splice Site 2945 3183 70 75
Genomic Location (Zv9):
Chromosome 6 (position 2408163)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 2480965
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGCAGCTCCATTTGAGGAGCAGACTGAAGGAGAGAGACACCTGCTCAGG[T/C]ACAGGATGCACACACATACACACAATACAGCACAGCATTAGTGTATCTCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link