nol9

Ensembl ID:
ENSDARG00000077751
ZFIN ID:
ZDB-GENE-070629-1
Human Orthologue:
NOL9
Human Description:
nucleolar protein 9 [Source:HGNC Symbol;Acc:26265]
Mouse Orthologue:
Nol9
Mouse Description:
nucleolar protein 9 Gene [Source:MGI Symbol;Acc:MGI:1921285]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa24337 Nonsense Mutation detected in F1 DNA During 2014
sa9241 Essential Splice Site Mutation detected in F1 DNA During 2014
sa1022 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa24337
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111755 Nonsense 22 713 1 12
ENSDART00000136941 Nonsense 22 175 2 3
ENSDART00000142124 Nonsense 22 713 2 13
Genomic Location:
Chromosome 23 (position 25244410)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TACACAAGGTTCATTCTCGGTCCCAACAGAGGCAGCGAAATGCATCTAAA[C/T]AACATGGCAAGAATAAGTGGAACAAAAAAGTGCGCAGCCTGGACTCAACG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9241
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111755 Essential Splice Site 164 713 None 12
ENSDART00000136941 Essential Splice Site 164 175 None 3
ENSDART00000142124 Essential Splice Site 164 713 None 13
Genomic Location:
Chromosome 23 (position 25244840)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCTTGATCATACCAAGAACCGTGCAGTGTTAGTCATGAAACAAAGTCAGG[T/G]AGGTTTACAGTACTCGAATACCAGAATGTCTAAATTTTGAATTTTTAGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1022
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111755 Nonsense 195 713 2 12
ENSDART00000136941 None None 175 None 3
ENSDART00000142124 Nonsense 195 713 3 13
Genomic Location:
Chromosome 23 (position 25246709)
KASP Assay ID:
554-0926.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGTCATGTAGAAGTGCTGGGCTTCACCATAGAGGAGGGTCAACAGCCTTA[C/A]CCTSTGTTTTCACCACCGACCCACTGCCCGCTCACTATCACGGCCTTAGG
Associated Phenotype:
Data not yet available
Transcriptome Profiling Preview:
View complete transcriptome profile
Region 3' end position 3' end strand Adjusted p-value Log2 fold change (mutant/sibling) Closest Ensembl gene 3' end Gene name e74 Ensembl Gene ID
10:22244801-22245326 22245326 1 2.15 × 10-194 1.5 0 npm1a ENSDARG00000014329
5:25765401-25766741 25766741 1 6.49 × 10-79 2.1 1 tp53 ENSDARG00000035559
22:40857801-40858664 40858664 1 7.23 × 10-70 -1.5 0 fetub ENSDARG00000053973
25:34827000-34827300 34827000 -1 6.01 × 10-61 2.4 2 rps27.2 ENSDARG00000090186
3:32493810-32494300 32493810 -1 6.71 × 10-57 1.1 -1 prmt1 ENSDARG00000010246

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/43bo7b1x