USP54 (1 of 2)

Ensembl ID:
ENSDARG00000077749
Description:
ubiquitin specific peptidase 54 [Source:HGNC Symbol;Acc:23513]
Human Orthologue:
USP54
Human Description:
ubiquitin specific peptidase 54 [Source:HGNC Symbol;Acc:23513]
Mouse Orthologue:
Usp54
Mouse Description:
ubiquitin specific peptidase 54 Gene [Source:MGI Symbol;Acc:MGI:1926037]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa5853 Nonsense Mutation detected in F1 DNA During 2014
sa11909 Nonsense Available for shipment Available now
sa22106 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa5853
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111558 Nonsense 339 1256 9 19
Genomic Location:
Chromosome 12 (position 27803332)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCCGAACGATCATAGATTGGTCCCAAGTGGAAGGACGTGGYGTCGAGATG[T/A]ATAAAAGGCCACTACCAACCTCTATTGCTGCTGTATGCTGACCCGCGTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11909
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111558 Nonsense 605 1256 11 19
Genomic Location:
Chromosome 12 (position 27797766)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGGGTGCGGTGGAGCCGGGAGTTGAGCATGTGCCAAACCCACCACCTTTA[C/T]GAGGTGTAGAACAGCAGCCTCGGCTGATCCAGAGGATGGAGAGTGGCKAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22106
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111558 Essential Splice Site 784 1256 14 19
Genomic Location:
Chromosome 12 (position 27791760)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGGCTGGGGACACAGCTACAGCCCTGGCGCTCTCCCACCACGCCGTGTG[T/G]AAGTAATTCTCACCTGCCTTTGCTTGCTATGCCCAACTCCTACGCTCTCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/i439icaq