
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
USP54 (1 of 2)
- Ensembl ID:
- ENSDARG00000077749
- Description:
- ubiquitin specific peptidase 54 [Source:HGNC Symbol;Acc:23513]
- Human Orthologue:
- USP54
- Human Description:
- ubiquitin specific peptidase 54 [Source:HGNC Symbol;Acc:23513]
- Mouse Orthologue:
- Usp54
- Mouse Description:
- ubiquitin specific peptidase 54 Gene [Source:MGI Symbol;Acc:MGI:1926037]
Alleles
There are 3 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa5853 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa11909 | Nonsense | Available for shipment | Available now |
sa22106 | Essential Splice Site | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa5853
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000111558 | Nonsense | 339 | 1256 | 9 | 19 |
- Genomic Location (Zv9):
- Chromosome 12 (position 27803332)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 12 26140941 GRCz11 12 26232301 - KASP Assay ID:
- 554-3907.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TCCGAACGATCATAGATTGGTCCCAAGTGGAAGGACGTGGYGTCGAGATG[T/A]ATAAAAGGCCACTACCAACCTCTATTGCTGCTGTATGCTGACCCGCGTGG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa11909
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000111558 | Nonsense | 605 | 1256 | 11 | 19 |
- Genomic Location (Zv9):
- Chromosome 12 (position 27797766)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 12 26135375 GRCz11 12 26226735 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- GGGGTGCGGTGGAGCCGGGAGTTGAGCATGTGCCAAACCCACCACCTTTA[C/T]GAGGTGTAGAACAGCAGCCTCGGCTGATCCAGAGGATGGAGAGTGGCKAC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa22106
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- T > G
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000111558 | Essential Splice Site | 784 | 1256 | 14 | 19 |
- Genomic Location (Zv9):
- Chromosome 12 (position 27791760)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 12 26128569 GRCz11 12 26219929 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CAGGCTGGGGACACAGCTACAGCCCTGGCGCTCTCCCACCACGCCGTGTG[T/G]AAGTAATTCTCACCTGCCTTTGCTTGCTATGCCCAACTCCTACGCTCTCT
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: